Mutagenetix > Incidental Mutations

Incidental Mutation 'R7834:Sall1'

605862

Institutional Source

Beutler Lab

Gene Symbol

Sall1

Ensembl Gene

ENSMUSG00000031665

Gene Name

spalt like transcription factor 1

Synonyms

Msal-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R7834 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89027235-89044162 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 89033374 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 34 (S34I)

Ref Sequence

ENSEMBL: ENSMUSP00000034090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034090]

Predicted Effect

probably benign
Transcript: ENSMUST00000034090
AA Change: S34I

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000034090
Gene: ENSMUSG00000031665
AA Change: S34I

Domain	Start	End	E-Value	Type
low complexity region	133	152	N/A	INTRINSIC
low complexity region	163	175	N/A	INTRINSIC
low complexity region	229	257	N/A	INTRINSIC
low complexity region	283	309	N/A	INTRINSIC
low complexity region	361	396	N/A	INTRINSIC
ZnF_C2H2	450	472	2.57e-3	SMART
ZnF_C2H2	478	500	3.21e-4	SMART
low complexity region	547	569	N/A	INTRINSIC
ZnF_C2H2	705	727	3.02e0	SMART
ZnF_C2H2	733	755	8.6e-5	SMART
ZnF_C2H2	765	787	1.6e-4	SMART
low complexity region	842	861	N/A	INTRINSIC
ZnF_C2H2	1000	1022	2.91e-2	SMART
ZnF_C2H2	1028	1050	4.94e-5	SMART
ZnF_C2H2	1133	1155	1.38e-3	SMART
ZnF_C2H2	1161	1183	1.22e-4	SMART
low complexity region	1257	1277	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional repressor and may be part of the NuRD histone deacetylase complex (HDAC). Defects in this gene are a cause of Townes-Brocks syndrome (TBS) as well as bronchio-oto-renal syndrome (BOR). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit kidney agenesis or dysgenesis and die perinatally. Homozygotes expressing only a truncated protein show renal agenesis, exencephaly, and limb defects; heterozygotes have hearing loss and cystic kidneys. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,284,724	I626N	probably damaging	Het
Abcc12	T	A	8: 86,531,550	Y779F	possibly damaging	Het
Abcc12	C	T	8: 86,558,230	C252Y	probably damaging	Het
Adam22	A	T	5: 8,130,535	C521S	probably damaging	Het
Adcy5	C	A	16: 35,157,200	H368N	probably benign	Het
Akap13	T	A	7: 75,742,642	I2411N	possibly damaging	Het
Ankrd12	A	G	17: 65,987,352	F339S	probably damaging	Het
Bmp1	T	A	14: 70,508,565	R153W	probably damaging	Het
Bmp6	T	C	13: 38,469,667	F237L	probably damaging	Het
Cacna1c	A	G	6: 118,610,581	S1628P		Het
Ccdc141	T	C	2: 77,059,545	R468G	possibly damaging	Het
Cdc40	A	T	10: 40,882,949	S43T	probably benign	Het
Celf4	A	G	18: 25,753,485	M48T	probably benign	Het
Clec4g	A	T	8: 3,716,500	M267K	probably damaging	Het
Col6a1	G	T	10: 76,709,928	S903R	unknown	Het
Creg2	A	G	1: 39,650,634	F103L	probably damaging	Het
Cul9	T	C	17: 46,525,704		probably null	Het
Dchs1	G	A	7: 105,765,567	A756V	probably benign	Het
Diaph1	G	A	18: 37,853,709		probably benign	Het
Dmxl1	G	A	18: 49,920,977	G2550D	probably damaging	Het
Dst	G	T	1: 34,194,105	R3396I	probably benign	Het
Dync2h1	T	C	9: 7,118,953	T2171A	probably benign	Het
Fgd2	C	T	17: 29,364,951	T113M	probably damaging	Het
Galnt6	G	T	15: 100,714,103	S219R	probably damaging	Het
Gbp6	T	A	5: 105,273,265	E558V	probably benign	Het
Gnas	A	T	2: 174,298,990	K377*	probably null	Het
Hars2	T	C	18: 36,789,581	I389T	probably damaging	Het
Hsp90ab1	T	C	17: 45,571,165	I123V	possibly damaging	Het
Igkv6-14	A	T	6: 70,435,008	N97K	possibly damaging	Het
Isg20	T	C	7: 78,920,119	L168P	probably damaging	Het
Kcna1	C	T	6: 126,642,740	D206N	probably benign	Het
Kcnn3	A	G	3: 89,521,354	I296V	probably damaging	Het
Kif18a	G	A	2: 109,296,774	R351H	probably damaging	Het
Klra5	A	T	6: 129,899,290		probably null	Het
Krt9	T	C	11: 100,192,666	T180A	probably benign	Het
Lhx8	T	C	3: 154,311,537	S323G	probably null	Het
Lpcat2	T	A	8: 92,918,101	L506H	possibly damaging	Het
Map2	A	G	1: 66,416,488	E1447G	probably damaging	Het
Mapk8ip2	A	T	15: 89,461,373	I779F	probably damaging	Het
Mcmdc2	G	A	1: 9,912,174		probably null	Het
Mrps15	G	A	4: 126,055,389	E217K	probably damaging	Het
Muc5b	G	A	7: 141,859,070	G1918R	unknown	Het
Mug2	T	C	6: 122,036,282	I336T	probably benign	Het
Myh10	T	C	11: 68,785,826	V878A	probably damaging	Het
Nomo1	T	C	7: 46,056,738		probably null	Het
Ogdhl	T	A	14: 32,340,709	I584N	probably benign	Het
Pdzrn3	G	A	6: 101,151,195	R837C	probably damaging	Het
Pkhd1	A	G	1: 20,312,049	M2626T	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Pnliprp2	T	C	19: 58,774,159	S399P	probably benign	Het
Prelp	T	C	1: 133,914,772	T212A	probably damaging	Het
Ptpn13	T	A	5: 103,462,148	S4T	probably damaging	Het
Ptprb	A	C	10: 116,339,424	E821A	probably benign	Het
Rabgap1	T	C	2: 37,469,407		probably benign	Het
Reln	C	T	5: 22,039,635	V782M	possibly damaging	Het
Rpl3l	T	C	17: 24,733,463	V52A	possibly damaging	Het
Rrp1b	T	C	17: 32,051,724	V219A	probably benign	Het
Rtn1	T	A	12: 72,304,032	I468F	probably damaging	Het
Safb	T	A	17: 56,593,881	M129K	unknown	Het
Slc2a8	C	T	2: 32,976,907	G227D	probably damaging	Het
Slco4a1	G	T	2: 180,465,677	V295L	probably benign	Het
Slfn5	A	T	11: 82,960,452	Q525L	possibly damaging	Het
Speg	C	T	1: 75,384,927	T195M	probably damaging	Het
Syne2	A	T	12: 75,967,247	T3071S	probably benign	Het
Syngr1	G	T	15: 80,111,617	W119L	probably damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Ush2a	G	A	1: 188,733,440	W2735*	probably null	Het
Usp17lb	T	A	7: 104,841,511	T70S	probably damaging	Het
Vmn2r6	T	G	3: 64,538,022	N761H	probably damaging	Het
Vps13d	A	T	4: 145,108,573	I2741K		Het
Wdr38	A	T	2: 39,000,184	Q110L	possibly damaging	Het
Zfp872	A	G	9: 22,200,110	K295R	probably damaging	Het

Other mutations in Sall1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Sall1	APN	8	89033344	missense	probably damaging	1.00
IGL01670:Sall1	APN	8	89031571	missense	probably benign	0.01
IGL01795:Sall1	APN	8	89028680	missense	probably benign	0.02
IGL02041:Sall1	APN	8	89031469	missense	probably damaging	1.00
IGL02078:Sall1	APN	8	89030375	missense	probably damaging	0.99
IGL02105:Sall1	APN	8	89032568	missense	probably damaging	0.99
IGL02354:Sall1	APN	8	89033049	missense	probably benign	0.10
IGL02727:Sall1	APN	8	89030755	missense	probably damaging	1.00
IGL02943:Sall1	APN	8	89031121	missense	probably damaging	0.99
IGL03179:Sall1	APN	8	89031661	missense	probably benign	0.00
PIT4651001:Sall1	UTSW	8	89031103	missense	probably damaging	1.00
R0089:Sall1	UTSW	8	89030268	missense	probably benign	0.09
R0386:Sall1	UTSW	8	89032604	missense	probably damaging	1.00
R0532:Sall1	UTSW	8	89033191	missense	probably benign
R0555:Sall1	UTSW	8	89031758	missense	probably benign	0.16
R1203:Sall1	UTSW	8	89031934	missense	probably damaging	1.00
R1406:Sall1	UTSW	8	89032444	missense	probably benign	0.34
R1406:Sall1	UTSW	8	89032444	missense	probably benign	0.34
R1449:Sall1	UTSW	8	89032483	missense	probably benign
R1477:Sall1	UTSW	8	89032882	missense	probably damaging	1.00
R1692:Sall1	UTSW	8	89028400	missense	probably benign	0.00
R1839:Sall1	UTSW	8	89028716	missense	possibly damaging	0.89
R2016:Sall1	UTSW	8	89028409	missense	probably benign	0.10
R2041:Sall1	UTSW	8	89032801	missense	probably benign
R3808:Sall1	UTSW	8	89031473	nonsense	probably null
R3816:Sall1	UTSW	8	89032675	missense	probably benign	0.00
R4085:Sall1	UTSW	8	89028509	missense	probably benign
R4604:Sall1	UTSW	8	89030341	missense	probably damaging	1.00
R4701:Sall1	UTSW	8	89031160	missense	probably damaging	1.00
R5760:Sall1	UTSW	8	89028650	missense	possibly damaging	0.94
R6091:Sall1	UTSW	8	89028619	missense	probably damaging	1.00
R6213:Sall1	UTSW	8	89033058	small deletion	probably benign
R6326:Sall1	UTSW	8	89030268	missense	probably benign	0.09
R6920:Sall1	UTSW	8	89030393	missense	probably damaging	1.00
R6954:Sall1	UTSW	8	89032891	missense	probably damaging	1.00
R7395:Sall1	UTSW	8	89030921	missense	possibly damaging	0.86
R7396:Sall1	UTSW	8	89032768	missense	probably damaging	1.00
R7493:Sall1	UTSW	8	89031053	missense	probably benign	0.32
R7555:Sall1	UTSW	8	89033158	missense	possibly damaging	0.90
R7672:Sall1	UTSW	8	89031299	missense	probably damaging	0.99
R7759:Sall1	UTSW	8	89042351	critical splice donor site	probably null
R8023:Sall1	UTSW	8	89032543	missense	probably damaging	0.99
R8166:Sall1	UTSW	8	89028518	missense	probably benign	0.27
R8708:Sall1	UTSW	8	89032855	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCGCTGCAGTCTTCTTG -3'
(R):5'- AATACAGCCTGGCTTTGGGG -3'

Sequencing Primer
(F):5'- TCGTCGGGATCATTGAGAGAC -3'
(R):5'- CATTACTGACAGTCTGTCC -3'

Posted On

2019-12-20