Incidental Mutation 'R7834:Col6a1'
ID 605869
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Name collagen, type VI, alpha 1
Synonyms Col6a-1
MMRRC Submission 045888-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.281) question?
Stock # R7834 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 76544626-76561878 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76545762 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 903 (S903R)
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
AlphaFold Q04857
Predicted Effect unknown
Transcript: ENSMUST00000001147
AA Change: S903R
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: S903R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,115,068 (GRCm39) I626N probably damaging Het
Abcc12 T A 8: 87,258,179 (GRCm39) Y779F possibly damaging Het
Abcc12 C T 8: 87,284,859 (GRCm39) C252Y probably damaging Het
Adam22 A T 5: 8,180,535 (GRCm39) C521S probably damaging Het
Adcy5 C A 16: 34,977,570 (GRCm39) H368N probably benign Het
Akap13 T A 7: 75,392,390 (GRCm39) I2411N possibly damaging Het
Ankrd12 A G 17: 66,294,347 (GRCm39) F339S probably damaging Het
Bmp1 T A 14: 70,746,005 (GRCm39) R153W probably damaging Het
Bmp6 T C 13: 38,653,643 (GRCm39) F237L probably damaging Het
Cacna1c A G 6: 118,587,542 (GRCm39) S1628P Het
Ccdc141 T C 2: 76,889,889 (GRCm39) R468G possibly damaging Het
Cdc40 A T 10: 40,758,945 (GRCm39) S43T probably benign Het
Celf4 A G 18: 25,886,542 (GRCm39) M48T probably benign Het
Clec4g A T 8: 3,766,500 (GRCm39) M267K probably damaging Het
Creg2 A G 1: 39,689,802 (GRCm39) F103L probably damaging Het
Cul9 T C 17: 46,836,630 (GRCm39) probably null Het
Dchs1 G A 7: 105,414,774 (GRCm39) A756V probably benign Het
Diaph1 G A 18: 37,986,762 (GRCm39) probably benign Het
Dmxl1 G A 18: 50,054,044 (GRCm39) G2550D probably damaging Het
Dst G T 1: 34,233,186 (GRCm39) R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 (GRCm39) T2171A probably benign Het
Fgd2 C T 17: 29,583,925 (GRCm39) T113M probably damaging Het
Galnt6 G T 15: 100,611,984 (GRCm39) S219R probably damaging Het
Gbp6 T A 5: 105,421,131 (GRCm39) E558V probably benign Het
Gnas A T 2: 174,140,783 (GRCm39) K377* probably null Het
Hars2 T C 18: 36,922,634 (GRCm39) I389T probably damaging Het
Hsp90ab1 T C 17: 45,882,091 (GRCm39) I123V possibly damaging Het
Igkv6-14 A T 6: 70,411,992 (GRCm39) N97K possibly damaging Het
Isg20 T C 7: 78,569,867 (GRCm39) L168P probably damaging Het
Kcna1 C T 6: 126,619,703 (GRCm39) D206N probably benign Het
Kcnn3 A G 3: 89,428,661 (GRCm39) I296V probably damaging Het
Kif18a G A 2: 109,127,119 (GRCm39) R351H probably damaging Het
Klra5 A T 6: 129,876,253 (GRCm39) probably null Het
Krt9 T C 11: 100,083,492 (GRCm39) T180A probably benign Het
Lhx8 T C 3: 154,017,174 (GRCm39) S323G probably null Het
Lpcat2 T A 8: 93,644,729 (GRCm39) L506H possibly damaging Het
Map2 A G 1: 66,455,647 (GRCm39) E1447G probably damaging Het
Mapk8ip2 A T 15: 89,345,576 (GRCm39) I779F probably damaging Het
Mcmdc2 G A 1: 9,982,399 (GRCm39) probably null Het
Mrps15 G A 4: 125,949,182 (GRCm39) E217K probably damaging Het
Muc5b G A 7: 141,412,807 (GRCm39) G1918R unknown Het
Mug2 T C 6: 122,013,241 (GRCm39) I336T probably benign Het
Myh10 T C 11: 68,676,652 (GRCm39) V878A probably damaging Het
Nomo1 T C 7: 45,706,162 (GRCm39) probably null Het
Ogdhl T A 14: 32,062,666 (GRCm39) I584N probably benign Het
Pdzrn3 G A 6: 101,128,156 (GRCm39) R837C probably damaging Het
Pkhd1 A G 1: 20,382,273 (GRCm39) M2626T probably benign Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Pnliprp2 T C 19: 58,762,591 (GRCm39) S399P probably benign Het
Prelp T C 1: 133,842,510 (GRCm39) T212A probably damaging Het
Ptpn13 T A 5: 103,610,014 (GRCm39) S4T probably damaging Het
Ptprb A C 10: 116,175,329 (GRCm39) E821A probably benign Het
Rabgap1 T C 2: 37,359,419 (GRCm39) probably benign Het
Reln C T 5: 22,244,633 (GRCm39) V782M possibly damaging Het
Rpl3l T C 17: 24,952,437 (GRCm39) V52A possibly damaging Het
Rrp1b T C 17: 32,270,698 (GRCm39) V219A probably benign Het
Rtn1 T A 12: 72,350,806 (GRCm39) I468F probably damaging Het
Safb T A 17: 56,900,881 (GRCm39) M129K unknown Het
Sall1 C A 8: 89,760,002 (GRCm39) S34I probably benign Het
Slc2a8 C T 2: 32,866,919 (GRCm39) G227D probably damaging Het
Slco4a1 G T 2: 180,107,470 (GRCm39) V295L probably benign Het
Slfn5 A T 11: 82,851,278 (GRCm39) Q525L possibly damaging Het
Speg C T 1: 75,361,571 (GRCm39) T195M probably damaging Het
Syne2 A T 12: 76,014,021 (GRCm39) T3071S probably benign Het
Syngr1 G T 15: 79,995,818 (GRCm39) W119L probably damaging Het
Tenm2 A G 11: 35,915,681 (GRCm39) L1951P probably damaging Het
Ulk4 C T 9: 121,092,734 (GRCm39) E168K possibly damaging Het
Ush2a G A 1: 188,465,637 (GRCm39) W2735* probably null Het
Usp17lb T A 7: 104,490,718 (GRCm39) T70S probably damaging Het
Vmn2r6 T G 3: 64,445,443 (GRCm39) N761H probably damaging Het
Vps13d A T 4: 144,835,143 (GRCm39) I2741K Het
Wdr38 A T 2: 38,890,196 (GRCm39) Q110L possibly damaging Het
Zfp872 A G 9: 22,111,406 (GRCm39) K295R probably damaging Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76,546,813 (GRCm39) missense unknown
IGL01943:Col6a1 APN 10 76,554,957 (GRCm39) critical splice donor site probably null
IGL02178:Col6a1 APN 10 76,546,909 (GRCm39) missense unknown
IGL02928:Col6a1 APN 10 76,545,500 (GRCm39) missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76,553,885 (GRCm39) splice site probably benign
P0005:Col6a1 UTSW 10 76,553,163 (GRCm39) splice site probably benign
R0398:Col6a1 UTSW 10 76,545,952 (GRCm39) missense unknown
R0631:Col6a1 UTSW 10 76,545,569 (GRCm39) missense probably benign 0.03
R0698:Col6a1 UTSW 10 76,552,114 (GRCm39) missense unknown
R0699:Col6a1 UTSW 10 76,552,114 (GRCm39) missense unknown
R0848:Col6a1 UTSW 10 76,549,458 (GRCm39) critical splice donor site probably null
R1053:Col6a1 UTSW 10 76,556,800 (GRCm39) missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76,548,158 (GRCm39) missense unknown
R1480:Col6a1 UTSW 10 76,545,752 (GRCm39) missense unknown
R1854:Col6a1 UTSW 10 76,557,783 (GRCm39) missense probably damaging 1.00
R1995:Col6a1 UTSW 10 76,557,790 (GRCm39) missense probably damaging 1.00
R2082:Col6a1 UTSW 10 76,545,430 (GRCm39) missense probably damaging 0.98
R2122:Col6a1 UTSW 10 76,557,332 (GRCm39) missense probably benign 0.10
R2411:Col6a1 UTSW 10 76,546,922 (GRCm39) missense unknown
R3236:Col6a1 UTSW 10 76,547,154 (GRCm39) missense unknown
R3417:Col6a1 UTSW 10 76,548,203 (GRCm39) missense unknown
R3832:Col6a1 UTSW 10 76,546,951 (GRCm39) missense unknown
R3843:Col6a1 UTSW 10 76,547,175 (GRCm39) missense unknown
R3903:Col6a1 UTSW 10 76,547,175 (GRCm39) missense unknown
R3904:Col6a1 UTSW 10 76,547,175 (GRCm39) missense unknown
R4409:Col6a1 UTSW 10 76,557,334 (GRCm39) missense probably benign 0.17
R4418:Col6a1 UTSW 10 76,554,239 (GRCm39) nonsense probably null
R4568:Col6a1 UTSW 10 76,555,031 (GRCm39) intron probably benign
R4579:Col6a1 UTSW 10 76,547,191 (GRCm39) missense unknown
R4661:Col6a1 UTSW 10 76,550,506 (GRCm39) missense unknown
R4945:Col6a1 UTSW 10 76,548,106 (GRCm39) missense unknown
R4958:Col6a1 UTSW 10 76,559,339 (GRCm39) missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76,545,740 (GRCm39) missense unknown
R5440:Col6a1 UTSW 10 76,559,288 (GRCm39) missense probably damaging 1.00
R5924:Col6a1 UTSW 10 76,554,205 (GRCm39) critical splice donor site probably null
R6030:Col6a1 UTSW 10 76,545,700 (GRCm39) missense unknown
R6030:Col6a1 UTSW 10 76,545,700 (GRCm39) missense unknown
R6366:Col6a1 UTSW 10 76,546,804 (GRCm39) missense unknown
R6435:Col6a1 UTSW 10 76,546,957 (GRCm39) missense unknown
R6718:Col6a1 UTSW 10 76,560,884 (GRCm39) missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76,557,277 (GRCm39) missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76,560,843 (GRCm39) missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76,546,175 (GRCm39) splice site probably null
R7183:Col6a1 UTSW 10 76,552,093 (GRCm39) critical splice donor site probably null
R7244:Col6a1 UTSW 10 76,553,242 (GRCm39) nonsense probably null
R7625:Col6a1 UTSW 10 76,549,760 (GRCm39) missense unknown
R7741:Col6a1 UTSW 10 76,545,743 (GRCm39) missense unknown
R7774:Col6a1 UTSW 10 76,545,710 (GRCm39) missense unknown
R8145:Col6a1 UTSW 10 76,559,305 (GRCm39) missense possibly damaging 0.46
R8177:Col6a1 UTSW 10 76,560,863 (GRCm39) missense probably damaging 1.00
R8932:Col6a1 UTSW 10 76,552,593 (GRCm39) missense unknown
R9060:Col6a1 UTSW 10 76,557,711 (GRCm39) missense probably benign 0.21
R9411:Col6a1 UTSW 10 76,547,487 (GRCm39) missense unknown
RF019:Col6a1 UTSW 10 76,547,449 (GRCm39) missense unknown
X0010:Col6a1 UTSW 10 76,559,372 (GRCm39) missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76,545,809 (GRCm39) missense unknown
Z1088:Col6a1 UTSW 10 76,545,393 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- AAGATCTCAATGCCTGCACGC -3'
(R):5'- TAGACAGCTCAGCCAGTGTC -3'

Sequencing Primer
(F):5'- GAGAGTTGCCGTCTGAAA -3'
(R):5'- TGTCGGCAGCCACAACTTC -3'
Posted On 2019-12-20