Incidental Mutation 'R7834:Ptprb'
ID605870
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7834 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 116339424 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 821 (E821A)
Ref Sequence ENSEMBL: ENSMUSP00000089805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: E821A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: E821A

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: E1108A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
R7833:Ptprb UTSW 10 116315251 missense probably benign 0.01
R7846:Ptprb UTSW 10 116283548 missense probably benign 0.17
R7896:Ptprb UTSW 10 116369457 splice site probably null
R7901:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7912:Ptprb UTSW 10 116322487 missense probably damaging 1.00
R8147:Ptprb UTSW 10 116317378 missense probably damaging 1.00
R8202:Ptprb UTSW 10 116353845 missense probably damaging 1.00
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Z1176:Ptprb UTSW 10 116302156 frame shift probably null
Z1177:Ptprb UTSW 10 116362642 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TATGTCAGGGGAAAGCAATCAC -3'
(R):5'- GATTTTGTAATGGCGCCCC -3'

Sequencing Primer
(F):5'- AGCAATCACGATTTAAGTAGTTGC -3'
(R):5'- ATGTCGTTGAAGAGCAGC -3'
Posted On2019-12-20