Mutagenetix > Incidental Mutation

Incidental Mutation 'R7834:Rtn1'

605875

Institutional Source

Beutler Lab

Gene Symbol

Rtn1

Ensembl Gene

ENSMUSG00000021087

Gene Name

reticulon 1

Synonyms

Rtn1-c, 0710005K15Rik, Nsp, Rtn1-b, Rtn1-a, 4930441F12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7834 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72211752-72409054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72304032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 468 (I468F)

Ref Sequence

ENSEMBL: ENSMUSP00000077594 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078505]

AlphaFold

Q8K0T0

Predicted Effect

probably damaging
Transcript: ENSMUST00000078505
AA Change: I468F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000077594
Gene: ENSMUSG00000021087
AA Change: I468F

Domain	Start	End	E-Value	Type
low complexity region	135	152	N/A	INTRINSIC
low complexity region	217	226	N/A	INTRINSIC
low complexity region	327	341	N/A	INTRINSIC
low complexity region	438	448	N/A	INTRINSIC
low complexity region	473	480	N/A	INTRINSIC
low complexity region	574	586	N/A	INTRINSIC
Pfam:Reticulon	593	757	2.2e-46	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,284,724	I626N	probably damaging	Het
Abcc12	T	A	8: 86,531,550	Y779F	possibly damaging	Het
Abcc12	C	T	8: 86,558,230	C252Y	probably damaging	Het
Adam22	A	T	5: 8,130,535	C521S	probably damaging	Het
Adcy5	C	A	16: 35,157,200	H368N	probably benign	Het
Akap13	T	A	7: 75,742,642	I2411N	possibly damaging	Het
Ankrd12	A	G	17: 65,987,352	F339S	probably damaging	Het
Bmp1	T	A	14: 70,508,565	R153W	probably damaging	Het
Bmp6	T	C	13: 38,469,667	F237L	probably damaging	Het
Cacna1c	A	G	6: 118,610,581	S1628P		Het
Ccdc141	T	C	2: 77,059,545	R468G	possibly damaging	Het
Cdc40	A	T	10: 40,882,949	S43T	probably benign	Het
Celf4	A	G	18: 25,753,485	M48T	probably benign	Het
Clec4g	A	T	8: 3,716,500	M267K	probably damaging	Het
Col6a1	G	T	10: 76,709,928	S903R	unknown	Het
Creg2	A	G	1: 39,650,634	F103L	probably damaging	Het
Cul9	T	C	17: 46,525,704		probably null	Het
Dchs1	G	A	7: 105,765,567	A756V	probably benign	Het
Diaph1	G	A	18: 37,853,709		probably benign	Het
Dmxl1	G	A	18: 49,920,977	G2550D	probably damaging	Het
Dst	G	T	1: 34,194,105	R3396I	probably benign	Het
Dync2h1	T	C	9: 7,118,953	T2171A	probably benign	Het
Fgd2	C	T	17: 29,364,951	T113M	probably damaging	Het
Galnt6	G	T	15: 100,714,103	S219R	probably damaging	Het
Gbp6	T	A	5: 105,273,265	E558V	probably benign	Het
Gnas	A	T	2: 174,298,990	K377*	probably null	Het
Hars2	T	C	18: 36,789,581	I389T	probably damaging	Het
Hsp90ab1	T	C	17: 45,571,165	I123V	possibly damaging	Het
Igkv6-14	A	T	6: 70,435,008	N97K	possibly damaging	Het
Isg20	T	C	7: 78,920,119	L168P	probably damaging	Het
Kcna1	C	T	6: 126,642,740	D206N	probably benign	Het
Kcnn3	A	G	3: 89,521,354	I296V	probably damaging	Het
Kif18a	G	A	2: 109,296,774	R351H	probably damaging	Het
Klra5	A	T	6: 129,899,290		probably null	Het
Krt9	T	C	11: 100,192,666	T180A	probably benign	Het
Lhx8	T	C	3: 154,311,537	S323G	probably null	Het
Lpcat2	T	A	8: 92,918,101	L506H	possibly damaging	Het
Map2	A	G	1: 66,416,488	E1447G	probably damaging	Het
Mapk8ip2	A	T	15: 89,461,373	I779F	probably damaging	Het
Mcmdc2	G	A	1: 9,912,174		probably null	Het
Mrps15	G	A	4: 126,055,389	E217K	probably damaging	Het
Muc5b	G	A	7: 141,859,070	G1918R	unknown	Het
Mug2	T	C	6: 122,036,282	I336T	probably benign	Het
Myh10	T	C	11: 68,785,826	V878A	probably damaging	Het
Nomo1	T	C	7: 46,056,738		probably null	Het
Ogdhl	T	A	14: 32,340,709	I584N	probably benign	Het
Pdzrn3	G	A	6: 101,151,195	R837C	probably damaging	Het
Pkhd1	A	G	1: 20,312,049	M2626T	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Pnliprp2	T	C	19: 58,774,159	S399P	probably benign	Het
Prelp	T	C	1: 133,914,772	T212A	probably damaging	Het
Ptpn13	T	A	5: 103,462,148	S4T	probably damaging	Het
Ptprb	A	C	10: 116,339,424	E821A	probably benign	Het
Rabgap1	T	C	2: 37,469,407		probably benign	Het
Reln	C	T	5: 22,039,635	V782M	possibly damaging	Het
Rpl3l	T	C	17: 24,733,463	V52A	possibly damaging	Het
Rrp1b	T	C	17: 32,051,724	V219A	probably benign	Het
Safb	T	A	17: 56,593,881	M129K	unknown	Het
Sall1	C	A	8: 89,033,374	S34I	probably benign	Het
Slc2a8	C	T	2: 32,976,907	G227D	probably damaging	Het
Slco4a1	G	T	2: 180,465,677	V295L	probably benign	Het
Slfn5	A	T	11: 82,960,452	Q525L	possibly damaging	Het
Speg	C	T	1: 75,384,927	T195M	probably damaging	Het
Syne2	A	T	12: 75,967,247	T3071S	probably benign	Het
Syngr1	G	T	15: 80,111,617	W119L	probably damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Ush2a	G	A	1: 188,733,440	W2735*	probably null	Het
Usp17lb	T	A	7: 104,841,511	T70S	probably damaging	Het
Vmn2r6	T	G	3: 64,538,022	N761H	probably damaging	Het
Vps13d	A	T	4: 145,108,573	I2741K		Het
Wdr38	A	T	2: 39,000,184	Q110L	possibly damaging	Het
Zfp872	A	G	9: 22,200,110	K295R	probably damaging	Het

Other mutations in Rtn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Rtn1	APN	12	72408511	missense	probably benign	0.18
IGL01335:Rtn1	APN	12	72308350	missense	probably benign
IGL01394:Rtn1	APN	12	72308416	missense	probably benign	0.00
IGL01551:Rtn1	APN	12	72216935	missense	possibly damaging	0.63
IGL01865:Rtn1	APN	12	72219300	missense	probably damaging	1.00
IGL02585:Rtn1	APN	12	72308155	critical splice donor site	probably null
PIT4802001:Rtn1	UTSW	12	72304326	missense	probably benign	0.21
R0104:Rtn1	UTSW	12	72308845	missense	probably damaging	0.99
R0866:Rtn1	UTSW	12	72308382	nonsense	probably null
R1099:Rtn1	UTSW	12	72304467	splice site	probably null
R1438:Rtn1	UTSW	12	72304413	missense	probably damaging	0.98
R1610:Rtn1	UTSW	12	72219279	missense	possibly damaging	0.90
R1694:Rtn1	UTSW	12	72223524	missense	probably damaging	1.00
R1869:Rtn1	UTSW	12	72308168	missense	probably damaging	1.00
R1888:Rtn1	UTSW	12	72236533	intron	probably benign
R1889:Rtn1	UTSW	12	72304410	missense	possibly damaging	0.87
R1892:Rtn1	UTSW	12	72212563	missense	probably damaging	1.00
R2418:Rtn1	UTSW	12	72304278	missense	probably benign
R2760:Rtn1	UTSW	12	72408362	missense	probably benign	0.00
R2973:Rtn1	UTSW	12	72223389	missense	probably damaging	1.00
R4567:Rtn1	UTSW	12	72212487	utr 3 prime	probably benign
R4880:Rtn1	UTSW	12	72217458	missense	possibly damaging	0.88
R4945:Rtn1	UTSW	12	72217484	missense	probably damaging	1.00
R6183:Rtn1	UTSW	12	72408491	missense	probably benign	0.09
R6493:Rtn1	UTSW	12	72308329	missense	probably damaging	0.99
R6547:Rtn1	UTSW	12	72308761	missense	possibly damaging	0.59
R6602:Rtn1	UTSW	12	72219318	missense	probably damaging	0.99
R7474:Rtn1	UTSW	12	72308390	missense	possibly damaging	0.87
R7615:Rtn1	UTSW	12	72304143	missense	probably damaging	1.00
R7697:Rtn1	UTSW	12	72408377	missense	probably benign	0.32
R7748:Rtn1	UTSW	12	72216926	missense	possibly damaging	0.53
R7754:Rtn1	UTSW	12	72308429	missense	probably damaging	0.96
R7970:Rtn1	UTSW	12	72308874	missense	probably benign	0.06
R8290:Rtn1	UTSW	12	72308419	missense	probably benign	0.07
R8311:Rtn1	UTSW	12	72304064	missense	probably damaging	1.00
R8440:Rtn1	UTSW	12	72223399	missense	probably damaging	1.00
R9393:Rtn1	UTSW	12	72216812	nonsense	probably null
R9579:Rtn1	UTSW	12	72223515	missense	probably damaging	0.99
R9632:Rtn1	UTSW	12	72304187	missense	probably damaging	1.00
Z1177:Rtn1	UTSW	12	72308864	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AACTCACAGCTTCCTCTTCAGG -3'
(R):5'- AATTGAGCTGGTGTCAGAGG -3'

Sequencing Primer
(F):5'- AGGCTCCATCTCCAGACGATG -3'
(R):5'- TGTCAGAGGACCCCATGG -3'

Posted On

2019-12-20