Mutagenetix > Incidental Mutation

Incidental Mutation 'R7834:Galnt6'

605882

Institutional Source

Beutler Lab

Gene Symbol

Galnt6

Ensembl Gene

ENSMUSG00000037280

Gene Name

polypeptide N-acetylgalactosaminyltransferase 6

Synonyms

GalNAc-T6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.230) question?

Stock #

R7834 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100691813-100729376 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 100714103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 219 (S219R)

Ref Sequence

ENSEMBL: ENSMUSP00000056705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052069] [ENSMUST00000159715] [ENSMUST00000161514]

AlphaFold

Q8C7U7

Predicted Effect

probably damaging
Transcript: ENSMUST00000052069
AA Change: S219R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000056705
Gene: ENSMUSG00000037280
AA Change: S219R

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	177	431	4.2e-10	PFAM
Pfam:Glycos_transf_2	180	366	8.8e-36	PFAM
Pfam:Glyco_transf_7C	337	415	8.5e-14	PFAM
RICIN	496	622	1.53e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159715
AA Change: S219R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123848
Gene: ENSMUSG00000037280
AA Change: S219R

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	177	432	1e-10	PFAM
Pfam:Glycos_transf_2	180	366	4.1e-31	PFAM
Pfam:Glyco_transf_7C	337	415	6.7e-13	PFAM
RICIN	496	622	1.53e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161514
AA Change: S219R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124793
Gene: ENSMUSG00000037280
AA Change: S219R

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	177	431	4.2e-10	PFAM
Pfam:Glycos_transf_2	180	366	8.8e-36	PFAM
Pfam:Glyco_transf_7C	337	415	8.5e-14	PFAM
RICIN	496	622	1.53e-27	SMART

Meta Mutation Damage Score

0.9268

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. The encoded protein is capable of glycosylating fibronectin peptide in vitro and is expressed in a fibroblast cell line, indicating that it may be involved in the synthesis of oncofetal fibronectin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,284,724	I626N	probably damaging	Het
Abcc12	T	A	8: 86,531,550	Y779F	possibly damaging	Het
Abcc12	C	T	8: 86,558,230	C252Y	probably damaging	Het
Adam22	A	T	5: 8,130,535	C521S	probably damaging	Het
Adcy5	C	A	16: 35,157,200	H368N	probably benign	Het
Akap13	T	A	7: 75,742,642	I2411N	possibly damaging	Het
Ankrd12	A	G	17: 65,987,352	F339S	probably damaging	Het
Bmp1	T	A	14: 70,508,565	R153W	probably damaging	Het
Bmp6	T	C	13: 38,469,667	F237L	probably damaging	Het
Cacna1c	A	G	6: 118,610,581	S1628P		Het
Ccdc141	T	C	2: 77,059,545	R468G	possibly damaging	Het
Cdc40	A	T	10: 40,882,949	S43T	probably benign	Het
Celf4	A	G	18: 25,753,485	M48T	probably benign	Het
Clec4g	A	T	8: 3,716,500	M267K	probably damaging	Het
Col6a1	G	T	10: 76,709,928	S903R	unknown	Het
Creg2	A	G	1: 39,650,634	F103L	probably damaging	Het
Cul9	T	C	17: 46,525,704		probably null	Het
Dchs1	G	A	7: 105,765,567	A756V	probably benign	Het
Diaph1	G	A	18: 37,853,709		probably benign	Het
Dmxl1	G	A	18: 49,920,977	G2550D	probably damaging	Het
Dst	G	T	1: 34,194,105	R3396I	probably benign	Het
Dync2h1	T	C	9: 7,118,953	T2171A	probably benign	Het
Fgd2	C	T	17: 29,364,951	T113M	probably damaging	Het
Gbp6	T	A	5: 105,273,265	E558V	probably benign	Het
Gnas	A	T	2: 174,298,990	K377*	probably null	Het
Hars2	T	C	18: 36,789,581	I389T	probably damaging	Het
Hsp90ab1	T	C	17: 45,571,165	I123V	possibly damaging	Het
Igkv6-14	A	T	6: 70,435,008	N97K	possibly damaging	Het
Isg20	T	C	7: 78,920,119	L168P	probably damaging	Het
Kcna1	C	T	6: 126,642,740	D206N	probably benign	Het
Kcnn3	A	G	3: 89,521,354	I296V	probably damaging	Het
Kif18a	G	A	2: 109,296,774	R351H	probably damaging	Het
Klra5	A	T	6: 129,899,290		probably null	Het
Krt9	T	C	11: 100,192,666	T180A	probably benign	Het
Lhx8	T	C	3: 154,311,537	S323G	probably null	Het
Lpcat2	T	A	8: 92,918,101	L506H	possibly damaging	Het
Map2	A	G	1: 66,416,488	E1447G	probably damaging	Het
Mapk8ip2	A	T	15: 89,461,373	I779F	probably damaging	Het
Mcmdc2	G	A	1: 9,912,174		probably null	Het
Mrps15	G	A	4: 126,055,389	E217K	probably damaging	Het
Muc5b	G	A	7: 141,859,070	G1918R	unknown	Het
Mug2	T	C	6: 122,036,282	I336T	probably benign	Het
Myh10	T	C	11: 68,785,826	V878A	probably damaging	Het
Nomo1	T	C	7: 46,056,738		probably null	Het
Ogdhl	T	A	14: 32,340,709	I584N	probably benign	Het
Pdzrn3	G	A	6: 101,151,195	R837C	probably damaging	Het
Pkhd1	A	G	1: 20,312,049	M2626T	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Pnliprp2	T	C	19: 58,774,159	S399P	probably benign	Het
Prelp	T	C	1: 133,914,772	T212A	probably damaging	Het
Ptpn13	T	A	5: 103,462,148	S4T	probably damaging	Het
Ptprb	A	C	10: 116,339,424	E821A	probably benign	Het
Rabgap1	T	C	2: 37,469,407		probably benign	Het
Reln	C	T	5: 22,039,635	V782M	possibly damaging	Het
Rpl3l	T	C	17: 24,733,463	V52A	possibly damaging	Het
Rrp1b	T	C	17: 32,051,724	V219A	probably benign	Het
Rtn1	T	A	12: 72,304,032	I468F	probably damaging	Het
Safb	T	A	17: 56,593,881	M129K	unknown	Het
Sall1	C	A	8: 89,033,374	S34I	probably benign	Het
Slc2a8	C	T	2: 32,976,907	G227D	probably damaging	Het
Slco4a1	G	T	2: 180,465,677	V295L	probably benign	Het
Slfn5	A	T	11: 82,960,452	Q525L	possibly damaging	Het
Speg	C	T	1: 75,384,927	T195M	probably damaging	Het
Syne2	A	T	12: 75,967,247	T3071S	probably benign	Het
Syngr1	G	T	15: 80,111,617	W119L	probably damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Ush2a	G	A	1: 188,733,440	W2735*	probably null	Het
Usp17lb	T	A	7: 104,841,511	T70S	probably damaging	Het
Vmn2r6	T	G	3: 64,538,022	N761H	probably damaging	Het
Vps13d	A	T	4: 145,108,573	I2741K		Het
Wdr38	A	T	2: 39,000,184	Q110L	possibly damaging	Het
Zfp872	A	G	9: 22,200,110	K295R	probably damaging	Het

Other mutations in Galnt6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02024:Galnt6	APN	15	100703493	missense	probably benign	0.16
IGL02606:Galnt6	APN	15	100714219	missense	probably damaging	1.00
R0325:Galnt6	UTSW	15	100693471	splice site	probably null
R0336:Galnt6	UTSW	15	100699206	missense	probably damaging	0.99
R0504:Galnt6	UTSW	15	100696657	splice site	probably benign
R1563:Galnt6	UTSW	15	100703378	missense	probably benign	0.00
R1903:Galnt6	UTSW	15	100716118	missense	possibly damaging	0.79
R2007:Galnt6	UTSW	15	100697166	missense	probably damaging	1.00
R2114:Galnt6	UTSW	15	100714241	missense	probably damaging	1.00
R2943:Galnt6	UTSW	15	100714279	splice site	probably null
R3410:Galnt6	UTSW	15	100699137	missense	probably damaging	1.00
R3954:Galnt6	UTSW	15	100697168	missense	possibly damaging	0.72
R4754:Galnt6	UTSW	15	100699224	missense	probably damaging	1.00
R4910:Galnt6	UTSW	15	100716178	missense	probably benign
R4911:Galnt6	UTSW	15	100716178	missense	probably benign
R4962:Galnt6	UTSW	15	100696574	nonsense	probably null
R5237:Galnt6	UTSW	15	100693393	missense	probably damaging	1.00
R5293:Galnt6	UTSW	15	100703501	missense	probably benign	0.00
R5605:Galnt6	UTSW	15	100697225	missense	probably damaging	1.00
R5752:Galnt6	UTSW	15	100704126	missense	probably damaging	1.00
R5837:Galnt6	UTSW	15	100694646	missense	possibly damaging	0.70
R5949:Galnt6	UTSW	15	100696550	missense	probably damaging	1.00
R6051:Galnt6	UTSW	15	100694668	missense	probably damaging	1.00
R6306:Galnt6	UTSW	15	100693424	missense	possibly damaging	0.70
R6522:Galnt6	UTSW	15	100693355	makesense	probably null
R6959:Galnt6	UTSW	15	100714125	missense	probably damaging	0.99
R7154:Galnt6	UTSW	15	100693464	missense	probably benign	0.05
R7450:Galnt6	UTSW	15	100697815	missense	probably damaging	1.00
R7908:Galnt6	UTSW	15	100703361	missense	probably damaging	1.00
R8143:Galnt6	UTSW	15	100716207	missense	probably damaging	0.98
R8212:Galnt6	UTSW	15	100693427	missense	probably benign	0.35
R8683:Galnt6	UTSW	15	100694722	missense	probably damaging	1.00
R8712:Galnt6	UTSW	15	100694620	missense	probably benign	0.01
R8906:Galnt6	UTSW	15	100703366	missense	probably damaging	1.00
R9294:Galnt6	UTSW	15	100704151	missense	possibly damaging	0.94
R9794:Galnt6	UTSW	15	100697978	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTCAAAGCTGCAGGACCC -3'
(R):5'- CCAGGTGTGTTGACCAGAAG -3'

Sequencing Primer
(F):5'- TCCTCCTCAGACCAGCGAG -3'
(R):5'- TGTTGACCAGAAGTTCCGGC -3'

Posted On

2019-12-20