Mutagenetix > Incidental Mutation

Incidental Mutation 'R7834:Adcy5'

605883

Institutional Source

Beutler Lab

Gene Symbol

Adcy5

Ensembl Gene

ENSMUSG00000022840

Gene Name

adenylate cyclase 5

Synonyms

AC5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R7834 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35154877-35305738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 35157200 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 368 (H368N)

Ref Sequence

ENSEMBL: ENSMUSP00000110563 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114913]

AlphaFold

P84309

Predicted Effect

probably benign
Transcript: ENSMUST00000114913
AA Change: H368N

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: H368N

Domain	Start	End	E-Value	Type
low complexity region	47	59	N/A	INTRINSIC
low complexity region	75	89	N/A	INTRINSIC
low complexity region	107	150	N/A	INTRINSIC
low complexity region	158	175	N/A	INTRINSIC
low complexity region	181	208	N/A	INTRINSIC
low complexity region	243	258	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	305	320	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
CYCc	424	623	2.62e-69	SMART
Pfam:DUF1053	669	762	1.8e-30	PFAM
transmembrane domain	794	816	N/A	INTRINSIC
transmembrane domain	837	856	N/A	INTRINSIC
transmembrane domain	910	932	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	985	1004	N/A	INTRINSIC
CYCc	1032	1240	2.98e-50	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,284,724	I626N	probably damaging	Het
Abcc12	T	A	8: 86,531,550	Y779F	possibly damaging	Het
Abcc12	C	T	8: 86,558,230	C252Y	probably damaging	Het
Adam22	A	T	5: 8,130,535	C521S	probably damaging	Het
Akap13	T	A	7: 75,742,642	I2411N	possibly damaging	Het
Ankrd12	A	G	17: 65,987,352	F339S	probably damaging	Het
Bmp1	T	A	14: 70,508,565	R153W	probably damaging	Het
Bmp6	T	C	13: 38,469,667	F237L	probably damaging	Het
Cacna1c	A	G	6: 118,610,581	S1628P		Het
Ccdc141	T	C	2: 77,059,545	R468G	possibly damaging	Het
Cdc40	A	T	10: 40,882,949	S43T	probably benign	Het
Celf4	A	G	18: 25,753,485	M48T	probably benign	Het
Clec4g	A	T	8: 3,716,500	M267K	probably damaging	Het
Col6a1	G	T	10: 76,709,928	S903R	unknown	Het
Creg2	A	G	1: 39,650,634	F103L	probably damaging	Het
Cul9	T	C	17: 46,525,704		probably null	Het
Dchs1	G	A	7: 105,765,567	A756V	probably benign	Het
Diaph1	G	A	18: 37,853,709		probably benign	Het
Dmxl1	G	A	18: 49,920,977	G2550D	probably damaging	Het
Dst	G	T	1: 34,194,105	R3396I	probably benign	Het
Dync2h1	T	C	9: 7,118,953	T2171A	probably benign	Het
Fgd2	C	T	17: 29,364,951	T113M	probably damaging	Het
Galnt6	G	T	15: 100,714,103	S219R	probably damaging	Het
Gbp6	T	A	5: 105,273,265	E558V	probably benign	Het
Gnas	A	T	2: 174,298,990	K377*	probably null	Het
Hars2	T	C	18: 36,789,581	I389T	probably damaging	Het
Hsp90ab1	T	C	17: 45,571,165	I123V	possibly damaging	Het
Igkv6-14	A	T	6: 70,435,008	N97K	possibly damaging	Het
Isg20	T	C	7: 78,920,119	L168P	probably damaging	Het
Kcna1	C	T	6: 126,642,740	D206N	probably benign	Het
Kcnn3	A	G	3: 89,521,354	I296V	probably damaging	Het
Kif18a	G	A	2: 109,296,774	R351H	probably damaging	Het
Klra5	A	T	6: 129,899,290		probably null	Het
Krt9	T	C	11: 100,192,666	T180A	probably benign	Het
Lhx8	T	C	3: 154,311,537	S323G	probably null	Het
Lpcat2	T	A	8: 92,918,101	L506H	possibly damaging	Het
Map2	A	G	1: 66,416,488	E1447G	probably damaging	Het
Mapk8ip2	A	T	15: 89,461,373	I779F	probably damaging	Het
Mcmdc2	G	A	1: 9,912,174		probably null	Het
Mrps15	G	A	4: 126,055,389	E217K	probably damaging	Het
Muc5b	G	A	7: 141,859,070	G1918R	unknown	Het
Mug2	T	C	6: 122,036,282	I336T	probably benign	Het
Myh10	T	C	11: 68,785,826	V878A	probably damaging	Het
Nomo1	T	C	7: 46,056,738		probably null	Het
Ogdhl	T	A	14: 32,340,709	I584N	probably benign	Het
Pdzrn3	G	A	6: 101,151,195	R837C	probably damaging	Het
Pkhd1	A	G	1: 20,312,049	M2626T	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Pnliprp2	T	C	19: 58,774,159	S399P	probably benign	Het
Prelp	T	C	1: 133,914,772	T212A	probably damaging	Het
Ptpn13	T	A	5: 103,462,148	S4T	probably damaging	Het
Ptprb	A	C	10: 116,339,424	E821A	probably benign	Het
Rabgap1	T	C	2: 37,469,407		probably benign	Het
Reln	C	T	5: 22,039,635	V782M	possibly damaging	Het
Rpl3l	T	C	17: 24,733,463	V52A	possibly damaging	Het
Rrp1b	T	C	17: 32,051,724	V219A	probably benign	Het
Rtn1	T	A	12: 72,304,032	I468F	probably damaging	Het
Safb	T	A	17: 56,593,881	M129K	unknown	Het
Sall1	C	A	8: 89,033,374	S34I	probably benign	Het
Slc2a8	C	T	2: 32,976,907	G227D	probably damaging	Het
Slco4a1	G	T	2: 180,465,677	V295L	probably benign	Het
Slfn5	A	T	11: 82,960,452	Q525L	possibly damaging	Het
Speg	C	T	1: 75,384,927	T195M	probably damaging	Het
Syne2	A	T	12: 75,967,247	T3071S	probably benign	Het
Syngr1	G	T	15: 80,111,617	W119L	probably damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Ush2a	G	A	1: 188,733,440	W2735*	probably null	Het
Usp17lb	T	A	7: 104,841,511	T70S	probably damaging	Het
Vmn2r6	T	G	3: 64,538,022	N761H	probably damaging	Het
Vps13d	A	T	4: 145,108,573	I2741K		Het
Wdr38	A	T	2: 39,000,184	Q110L	possibly damaging	Het
Zfp872	A	G	9: 22,200,110	K295R	probably damaging	Het

Other mutations in Adcy5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Adcy5	APN	16	35253213	missense	possibly damaging	0.49
IGL01583:Adcy5	APN	16	35283513	splice site	probably benign
IGL01608:Adcy5	APN	16	35272165	missense	probably damaging	1.00
IGL02097:Adcy5	APN	16	35272098	missense	probably damaging	1.00
IGL02122:Adcy5	APN	16	35283612	splice site	probably benign
IGL02532:Adcy5	APN	16	35272083	missense	possibly damaging	0.79
IGL02814:Adcy5	APN	16	35303649	missense	probably benign	0.08
IGL02877:Adcy5	APN	16	35298600	missense	probably damaging	1.00
IGL03026:Adcy5	APN	16	35157042	missense	probably benign	0.41
IGL03345:Adcy5	APN	16	35248814	missense	probably benign	0.05
H8562:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
H8786:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
R0050:Adcy5	UTSW	16	35304303	utr 3 prime	probably benign
R0091:Adcy5	UTSW	16	35270998	critical splice donor site	probably null
R0112:Adcy5	UTSW	16	35156178	missense	possibly damaging	0.85
R0398:Adcy5	UTSW	16	35269068	missense	probably damaging	1.00
R0457:Adcy5	UTSW	16	35274545	missense	probably benign	0.07
R0554:Adcy5	UTSW	16	35294017	missense	probably benign	0.26
R0698:Adcy5	UTSW	16	35290082	missense	possibly damaging	0.78
R0761:Adcy5	UTSW	16	35270825	splice site	probably benign
R0865:Adcy5	UTSW	16	35274471	missense	probably damaging	0.96
R0927:Adcy5	UTSW	16	35156243	missense	probably benign	0.32
R0945:Adcy5	UTSW	16	35290111	missense	probably benign
R1534:Adcy5	UTSW	16	35253259	missense	possibly damaging	0.92
R1565:Adcy5	UTSW	16	35268957	missense	probably damaging	1.00
R1721:Adcy5	UTSW	16	35298424	missense	probably damaging	1.00
R1839:Adcy5	UTSW	16	35248940	missense	probably damaging	1.00
R2047:Adcy5	UTSW	16	35290108	missense	possibly damaging	0.78
R3052:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3053:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3827:Adcy5	UTSW	16	35290097	missense	probably benign	0.03
R4398:Adcy5	UTSW	16	35268993	missense	probably damaging	1.00
R4700:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R4965:Adcy5	UTSW	16	35278502	missense	possibly damaging	0.82
R5229:Adcy5	UTSW	16	35269070	missense	probably damaging	0.99
R5456:Adcy5	UTSW	16	35298522	missense	probably damaging	1.00
R5586:Adcy5	UTSW	16	35157116	missense	probably damaging	0.99
R5757:Adcy5	UTSW	16	35272081	missense	probably damaging	1.00
R5959:Adcy5	UTSW	16	35298410	missense	probably damaging	1.00
R6011:Adcy5	UTSW	16	35157228	missense	probably benign	0.05
R6277:Adcy5	UTSW	16	35289526	missense	probably benign	0.02
R6296:Adcy5	UTSW	16	35303710	missense	probably damaging	1.00
R6379:Adcy5	UTSW	16	35293999	missense	probably benign	0.13
R6431:Adcy5	UTSW	16	35279237	missense	probably damaging	1.00
R6685:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R6728:Adcy5	UTSW	16	35157165	missense	possibly damaging	0.88
R6755:Adcy5	UTSW	16	35303634	missense	possibly damaging	0.95
R6887:Adcy5	UTSW	16	35298590	missense	possibly damaging	0.74
R7029:Adcy5	UTSW	16	35299648	missense	probably null	0.91
R7047:Adcy5	UTSW	16	35267215	missense	probably damaging	1.00
R7050:Adcy5	UTSW	16	35303700	missense	possibly damaging	0.88
R7102:Adcy5	UTSW	16	35299625	missense	probably damaging	1.00
R7150:Adcy5	UTSW	16	35298534	missense	probably damaging	1.00
R7242:Adcy5	UTSW	16	35156835	missense	probably damaging	1.00
R7387:Adcy5	UTSW	16	35272090	missense	probably damaging	1.00
R7654:Adcy5	UTSW	16	35270947	missense	probably damaging	1.00
R7718:Adcy5	UTSW	16	35280415	missense	probably benign	0.42
R8172:Adcy5	UTSW	16	35157057	missense	probably damaging	0.96
R8772:Adcy5	UTSW	16	35299588	missense	probably damaging	1.00
R8983:Adcy5	UTSW	16	35156862	missense	possibly damaging	0.88
R9031:Adcy5	UTSW	16	35299489	missense	probably damaging	1.00
R9070:Adcy5	UTSW	16	35280400	missense	probably damaging	0.99
R9149:Adcy5	UTSW	16	35272111	missense	probably damaging	1.00
R9190:Adcy5	UTSW	16	35268994	nonsense	probably null
R9256:Adcy5	UTSW	16	35303682	missense	probably damaging	1.00
R9557:Adcy5	UTSW	16	35270957	missense	probably damaging	1.00
R9776:Adcy5	UTSW	16	35280355	missense	probably damaging	1.00
V7732:Adcy5	UTSW	16	35283541	missense	probably benign	0.00
X0022:Adcy5	UTSW	16	35299456	missense	probably damaging	0.99
Z1176:Adcy5	UTSW	16	35156321	missense	unknown
Z1176:Adcy5	UTSW	16	35290185	missense	probably benign	0.03
Z1176:Adcy5	UTSW	16	35291544	missense	not run
Z1177:Adcy5	UTSW	16	35291544	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTATGCGCTCATTGCAGTGG -3'
(R):5'- GCATTACAAGCCTTACAAGAGTAG -3'

Sequencing Primer
(F):5'- CAGTGGTGCTGGCCGTC -3'
(R):5'- GCCTTACAAGAGTAGTCTTTAGTAGG -3'

Posted On

2019-12-20