Incidental Mutation 'R7834:Safb'
ID605889
Institutional Source Beutler Lab
Gene Symbol Safb
Ensembl Gene ENSMUSG00000071054
Gene Namescaffold attachment factor B
Synonyms3110021E02Rik, SAFB1, 5330423C17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R7834 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56584825-56606294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56593881 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 129 (M129K)
Ref Sequence ENSEMBL: ENSMUSP00000138277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095224] [ENSMUST00000182533] [ENSMUST00000182800]
Predicted Effect unknown
Transcript: ENSMUST00000095224
AA Change: M129K
SMART Domains Protein: ENSMUSP00000092849
Gene: ENSMUSG00000071054
AA Change: M129K

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182533
AA Change: M129K
SMART Domains Protein: ENSMUSP00000138277
Gene: ENSMUSG00000071054
AA Change: M129K

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182800
Predicted Effect probably damaging
Transcript: ENSMUST00000182951
AA Change: M46K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein which has high specificity for scaffold or matrix attachment region DNA elements (S/MAR DNA). This protein is thought to be involved in attaching the base of chromatin loops to the nuclear matrix but there is conflicting evidence as to whether this protein is a component of chromatin or a nuclear matrix protein. Scaffold attachment factors are a specific subset of nuclear matrix proteins (NMP) that specifically bind to S/MAR. The encoded protein is thought to serve as a molecular base to assemble a 'transcriptosome complex' in the vicinity of actively transcribed genes. It is involved in the regulation of heat shock protein 27 transcription, can act as an estrogen receptor co-repressor and is a candidate for breast tumorigenesis. This gene is arranged head-to-head with a similar gene whose product has the same functions. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and neonatal lethality, neonatal cyanosis, impaired embryonic hematopoiesis, male sterility, azoospermia, reduced female fertility, impaired transport of embryos through the oviduct, reduced embryonic growth, testicular degeneration and ovarian atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Safb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Safb APN 17 56602974 unclassified probably benign
IGL02391:Safb APN 17 56600813 splice site probably benign
IGL03145:Safb APN 17 56605287 missense probably damaging 1.00
R0245:Safb UTSW 17 56606025 missense probably damaging 1.00
R0464:Safb UTSW 17 56606025 missense probably damaging 1.00
R0468:Safb UTSW 17 56606025 missense probably damaging 1.00
R0479:Safb UTSW 17 56606025 missense probably damaging 1.00
R0496:Safb UTSW 17 56605630 missense probably benign 0.05
R0639:Safb UTSW 17 56601092 utr 3 prime probably benign
R0655:Safb UTSW 17 56597803 missense probably benign 0.23
R1109:Safb UTSW 17 56601228 splice site probably benign
R1941:Safb UTSW 17 56598992 intron probably benign
R1969:Safb UTSW 17 56605821 missense probably benign 0.32
R1971:Safb UTSW 17 56605821 missense probably benign 0.32
R4010:Safb UTSW 17 56603765 unclassified probably benign
R4132:Safb UTSW 17 56600848 utr 3 prime probably benign
R5429:Safb UTSW 17 56588822 missense probably benign 0.15
R5681:Safb UTSW 17 56599000 intron probably benign
R5900:Safb UTSW 17 56600349 missense unknown
R6077:Safb UTSW 17 56602956 unclassified probably benign
R6173:Safb UTSW 17 56597798 missense probably damaging 1.00
R6367:Safb UTSW 17 56593845 unclassified probably benign
R6735:Safb UTSW 17 56585169 unclassified probably benign
R6736:Safb UTSW 17 56606023 missense possibly damaging 0.46
R7909:Safb UTSW 17 56595665 missense unknown
R8167:Safb UTSW 17 56585286 missense unknown
X0065:Safb UTSW 17 56603798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCTTCAGGGAGGAAACC -3'
(R):5'- AACTTTGCATCAGGCCACC -3'

Sequencing Primer
(F):5'- TCTCTTCAGGGAGGAAACCAGAAG -3'
(R):5'- ATCAGGCCACCCAGTGCTC -3'
Posted On2019-12-20