Mutagenetix > Incidental Mutations

Incidental Mutation 'R7834:Pnliprp2'

605895

Institutional Source

Beutler Lab

Gene Symbol

Pnliprp2

Ensembl Gene

ENSMUSG00000025091

Gene Name

pancreatic lipase-related protein 2

Synonyms

PLRP2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R7834 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58759723-58777533 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58774159 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 399 (S399P)

Ref Sequence

ENSEMBL: ENSMUSP00000026081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026081]

Predicted Effect

probably benign
Transcript: ENSMUST00000026081
AA Change: S399P

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000026081
Gene: ENSMUSG00000025091
AA Change: S399P

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:Lipase	31	367	4.1e-166	PFAM
LH2	370	482	7.49e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lipase that hydrolyzes galactolipids, the main components of plant membrane lipids. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display deficient lipid absorbtion before weaning which results in growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,284,724	I626N	probably damaging	Het
Abcc12	T	A	8: 86,531,550	Y779F	possibly damaging	Het
Abcc12	C	T	8: 86,558,230	C252Y	probably damaging	Het
Adam22	A	T	5: 8,130,535	C521S	probably damaging	Het
Adcy5	C	A	16: 35,157,200	H368N	probably benign	Het
Akap13	T	A	7: 75,742,642	I2411N	possibly damaging	Het
Ankrd12	A	G	17: 65,987,352	F339S	probably damaging	Het
Bmp1	T	A	14: 70,508,565	R153W	probably damaging	Het
Bmp6	T	C	13: 38,469,667	F237L	probably damaging	Het
Cacna1c	A	G	6: 118,610,581	S1628P		Het
Ccdc141	T	C	2: 77,059,545	R468G	possibly damaging	Het
Cdc40	A	T	10: 40,882,949	S43T	probably benign	Het
Celf4	A	G	18: 25,753,485	M48T	probably benign	Het
Clec4g	A	T	8: 3,716,500	M267K	probably damaging	Het
Col6a1	G	T	10: 76,709,928	S903R	unknown	Het
Creg2	A	G	1: 39,650,634	F103L	probably damaging	Het
Cul9	T	C	17: 46,525,704		probably null	Het
Dchs1	G	A	7: 105,765,567	A756V	probably benign	Het
Diaph1	G	A	18: 37,853,709		probably benign	Het
Dmxl1	G	A	18: 49,920,977	G2550D	probably damaging	Het
Dst	G	T	1: 34,194,105	R3396I	probably benign	Het
Dync2h1	T	C	9: 7,118,953	T2171A	probably benign	Het
Fgd2	C	T	17: 29,364,951	T113M	probably damaging	Het
Galnt6	G	T	15: 100,714,103	S219R	probably damaging	Het
Gbp6	T	A	5: 105,273,265	E558V	probably benign	Het
Gnas	A	T	2: 174,298,990	K377*	probably null	Het
Hars2	T	C	18: 36,789,581	I389T	probably damaging	Het
Hsp90ab1	T	C	17: 45,571,165	I123V	possibly damaging	Het
Igkv6-14	A	T	6: 70,435,008	N97K	possibly damaging	Het
Isg20	T	C	7: 78,920,119	L168P	probably damaging	Het
Kcna1	C	T	6: 126,642,740	D206N	probably benign	Het
Kcnn3	A	G	3: 89,521,354	I296V	probably damaging	Het
Kif18a	G	A	2: 109,296,774	R351H	probably damaging	Het
Klra5	A	T	6: 129,899,290		probably null	Het
Krt9	T	C	11: 100,192,666	T180A	probably benign	Het
Lhx8	T	C	3: 154,311,537	S323G	probably null	Het
Lpcat2	T	A	8: 92,918,101	L506H	possibly damaging	Het
Map2	A	G	1: 66,416,488	E1447G	probably damaging	Het
Mapk8ip2	A	T	15: 89,461,373	I779F	probably damaging	Het
Mcmdc2	G	A	1: 9,912,174		probably null	Het
Mrps15	G	A	4: 126,055,389	E217K	probably damaging	Het
Muc5b	G	A	7: 141,859,070	G1918R	unknown	Het
Mug2	T	C	6: 122,036,282	I336T	probably benign	Het
Myh10	T	C	11: 68,785,826	V878A	probably damaging	Het
Nomo1	T	C	7: 46,056,738		probably null	Het
Ogdhl	T	A	14: 32,340,709	I584N	probably benign	Het
Pdzrn3	G	A	6: 101,151,195	R837C	probably damaging	Het
Pkhd1	A	G	1: 20,312,049	M2626T	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Prelp	T	C	1: 133,914,772	T212A	probably damaging	Het
Ptpn13	T	A	5: 103,462,148	S4T	probably damaging	Het
Ptprb	A	C	10: 116,339,424	E821A	probably benign	Het
Rabgap1	T	C	2: 37,469,407		probably benign	Het
Reln	C	T	5: 22,039,635	V782M	possibly damaging	Het
Rpl3l	T	C	17: 24,733,463	V52A	possibly damaging	Het
Rrp1b	T	C	17: 32,051,724	V219A	probably benign	Het
Rtn1	T	A	12: 72,304,032	I468F	probably damaging	Het
Safb	T	A	17: 56,593,881	M129K	unknown	Het
Sall1	C	A	8: 89,033,374	S34I	probably benign	Het
Slc2a8	C	T	2: 32,976,907	G227D	probably damaging	Het
Slco4a1	G	T	2: 180,465,677	V295L	probably benign	Het
Slfn5	A	T	11: 82,960,452	Q525L	possibly damaging	Het
Speg	C	T	1: 75,384,927	T195M	probably damaging	Het
Syne2	A	T	12: 75,967,247	T3071S	probably benign	Het
Syngr1	G	T	15: 80,111,617	W119L	probably damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Ush2a	G	A	1: 188,733,440	W2735*	probably null	Het
Usp17lb	T	A	7: 104,841,511	T70S	probably damaging	Het
Vmn2r6	T	G	3: 64,538,022	N761H	probably damaging	Het
Vps13d	A	T	4: 145,108,573	I2741K		Het
Wdr38	A	T	2: 39,000,184	Q110L	possibly damaging	Het
Zfp872	A	G	9: 22,200,110	K295R	probably damaging	Het

Other mutations in Pnliprp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00786:Pnliprp2	APN	19	58760497	missense	probably benign
IGL02739:Pnliprp2	APN	19	58760509	critical splice donor site	probably null
IGL02881:Pnliprp2	APN	19	58771446	missense	probably benign	0.01
IGL03411:Pnliprp2	APN	19	58760415	missense	probably benign
R0140:Pnliprp2	UTSW	19	58766363	missense	probably benign	0.00
R0558:Pnliprp2	UTSW	19	58774087	missense	probably benign	0.00
R1873:Pnliprp2	UTSW	19	58763389	missense	probably benign	0.00
R1874:Pnliprp2	UTSW	19	58763389	missense	probably benign	0.00
R1875:Pnliprp2	UTSW	19	58763389	missense	probably benign	0.00
R2382:Pnliprp2	UTSW	19	58768630	missense	probably benign	0.00
R3893:Pnliprp2	UTSW	19	58766273	missense	probably benign	0.19
R3915:Pnliprp2	UTSW	19	58760362	missense	probably damaging	1.00
R4620:Pnliprp2	UTSW	19	58762286	missense	possibly damaging	0.67
R4893:Pnliprp2	UTSW	19	58771421	missense	probably benign	0.08
R4957:Pnliprp2	UTSW	19	58775145	missense	possibly damaging	0.72
R4959:Pnliprp2	UTSW	19	58766318	missense	probably benign	0.16
R4973:Pnliprp2	UTSW	19	58766318	missense	probably benign	0.16
R5346:Pnliprp2	UTSW	19	58759800	missense	probably benign
R6049:Pnliprp2	UTSW	19	58760452	missense	possibly damaging	0.77
R6228:Pnliprp2	UTSW	19	58763442	critical splice donor site	probably null
R6394:Pnliprp2	UTSW	19	58761598	missense	probably benign
R6829:Pnliprp2	UTSW	19	58759873	missense	probably benign
R7235:Pnliprp2	UTSW	19	58775227	missense	probably benign	0.03
R7534:Pnliprp2	UTSW	19	58775142	missense	probably benign
R8015:Pnliprp2	UTSW	19	58766282	missense	probably damaging	0.99
R8508:Pnliprp2	UTSW	19	58763374	missense	probably damaging	1.00
X0058:Pnliprp2	UTSW	19	58774142	missense	possibly damaging	0.59
Z1088:Pnliprp2	UTSW	19	58762325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCTAGGGGAAGCCAATCTTAG -3'
(R):5'- GCAATCACCATGTGACCCATTG -3'

Sequencing Primer
(F):5'- GAAAAATAACACTTCCAGTCGAGTC -3'
(R):5'- GTAAACAATGGTCTCTCTCACAGGG -3'

Posted On

2019-12-20