Incidental Mutation 'R7835:Ihh'
ID605897
Institutional Source Beutler Lab
Gene Symbol Ihh
Ensembl Gene ENSMUSG00000006538
Gene NameIndian hedgehog
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74945315-74951672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74946366 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 320 (V320A)
Ref Sequence ENSEMBL: ENSMUSP00000128056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164097]
Predicted Effect probably damaging
Transcript: ENSMUST00000164097
AA Change: V320A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128056
Gene: ENSMUSG00000006538
AA Change: V320A

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Pfam:HH_signal 66 227 2.7e-88 PFAM
HintN 239 346 3.15e-29 SMART
HintC 347 391 3.5e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including an N-terminal fragment that is involved in signaling. Hedgehog family proteins are essential secreted signaling molecules that regulate a variety of developmental processes including growth, patterning and morphogenesis. The protein encoded by this gene specifically plays a role in bone growth and differentiation. Mutations in this gene are the cause of brachydactyly type A1, which is characterized by shortening or malformation of the fingers and toes. Mutations in this gene are also the cause of acrocapitofemoral dysplasia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes die before or immediately after birth due to respiratory failure, exhibiting limb dwarfism associated with reduced chondrocyte proliferation, ectopic maturation of chondrocytes, and a failure of osteoblast development in endochondral bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Ihh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ihh APN 1 74946442 missense probably damaging 1.00
IGL02174:Ihh APN 1 74950946 missense probably damaging 0.98
Echidna UTSW 1 74946727 missense probably benign 0.08
R0047:Ihh UTSW 1 74946591 missense probably benign 0.01
R0047:Ihh UTSW 1 74946591 missense probably benign 0.01
R1404:Ihh UTSW 1 74951213 start codon destroyed probably null
R1404:Ihh UTSW 1 74951213 start codon destroyed probably null
R2936:Ihh UTSW 1 74946546 missense probably damaging 0.97
R4520:Ihh UTSW 1 74950950 missense probably damaging 1.00
R4540:Ihh UTSW 1 74948399 missense possibly damaging 0.94
R5399:Ihh UTSW 1 74946277 missense probably benign 0.00
R5736:Ihh UTSW 1 74946127 missense probably benign
R6026:Ihh UTSW 1 74946727 missense probably benign 0.08
R6073:Ihh UTSW 1 74951279 utr 5 prime probably benign
R6458:Ihh UTSW 1 74946442 missense probably damaging 1.00
R6489:Ihh UTSW 1 74946511 missense probably damaging 1.00
R7311:Ihh UTSW 1 74951147 missense unknown
R7350:Ihh UTSW 1 74948333 missense probably damaging 1.00
R7818:Ihh UTSW 1 74946645 missense possibly damaging 0.84
Z1176:Ihh UTSW 1 74946094 missense probably damaging 1.00
Z1189:Ihh UTSW 1 74951045 missense probably damaging 1.00
Z1192:Ihh UTSW 1 74951045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGGTGCTCTCTTCTAGC -3'
(R):5'- ATCGAGACTCAGGATCCTCC -3'

Sequencing Primer
(F):5'- TCTTCTAGCAAGAGACGCCC -3'
(R):5'- ACTCAGGATCCTCCGCGTC -3'
Posted On2019-12-20