Incidental Mutation 'R7835:Ihh'
ID 605897
Institutional Source Beutler Lab
Gene Symbol Ihh
Ensembl Gene ENSMUSG00000006538
Gene Name Indian hedgehog
Synonyms
MMRRC Submission 045889-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7835 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74984474-74990831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74985525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 320 (V320A)
Ref Sequence ENSEMBL: ENSMUSP00000128056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164097]
AlphaFold P97812
Predicted Effect probably damaging
Transcript: ENSMUST00000164097
AA Change: V320A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128056
Gene: ENSMUSG00000006538
AA Change: V320A

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Pfam:HH_signal 66 227 2.7e-88 PFAM
HintN 239 346 3.15e-29 SMART
HintC 347 391 3.5e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including an N-terminal fragment that is involved in signaling. Hedgehog family proteins are essential secreted signaling molecules that regulate a variety of developmental processes including growth, patterning and morphogenesis. The protein encoded by this gene specifically plays a role in bone growth and differentiation. Mutations in this gene are the cause of brachydactyly type A1, which is characterized by shortening or malformation of the fingers and toes. Mutations in this gene are also the cause of acrocapitofemoral dysplasia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes die before or immediately after birth due to respiratory failure, exhibiting limb dwarfism associated with reduced chondrocyte proliferation, ectopic maturation of chondrocytes, and a failure of osteoblast development in endochondral bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 78,749,623 (GRCm39) S1465T probably benign Het
Accsl T A 2: 93,696,329 (GRCm39) K90* probably null Het
Adamts3 A T 5: 89,848,299 (GRCm39) D674E possibly damaging Het
Adap2 T A 11: 80,051,057 (GRCm39) V129D probably benign Het
Ank3 A G 10: 69,823,557 (GRCm39) D742G Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cachd1 G T 4: 100,831,350 (GRCm39) probably null Het
Ccne1 G T 7: 37,802,270 (GRCm39) Q133K probably benign Het
Cers3 C T 7: 66,423,387 (GRCm39) H111Y possibly damaging Het
Chst5 A T 8: 112,617,234 (GRCm39) L129M probably damaging Het
Depdc7 A G 2: 104,558,530 (GRCm39) S164P probably benign Het
Dnah10 G A 5: 124,854,298 (GRCm39) A1966T probably damaging Het
Fcgbp T G 7: 27,816,632 (GRCm39) S2365A possibly damaging Het
Kdm5d T C Y: 900,558 (GRCm39) V201A possibly damaging Het
Kif13b T A 14: 65,004,901 (GRCm39) H1117Q probably benign Het
Lcn8 C A 2: 25,545,308 (GRCm39) probably null Het
Lrp4 T C 2: 91,325,387 (GRCm39) V1404A possibly damaging Het
Lrrc61 A T 6: 48,545,506 (GRCm39) T110S probably benign Het
Mrpl19 G A 6: 81,939,107 (GRCm39) R232C probably damaging Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Mzt1 T C 14: 99,283,439 (GRCm39) T21A probably benign Het
Naip6 G T 13: 100,452,512 (GRCm39) A183E probably benign Het
Neb T C 2: 52,040,589 (GRCm39) D6624G probably benign Het
Nup85 A G 11: 115,460,897 (GRCm39) D183G probably benign Het
Olfm5 A T 7: 103,803,652 (GRCm39) Y195* probably null Het
Or7g16 T A 9: 18,727,105 (GRCm39) M162L probably benign Het
Piezo2 A T 18: 63,216,016 (GRCm39) F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Polr1a T C 6: 71,892,126 (GRCm39) V135A probably benign Het
Ppcdc A G 9: 57,327,559 (GRCm39) S83P probably benign Het
Prss21 A T 17: 24,088,425 (GRCm39) Q130L possibly damaging Het
Rdx T A 9: 51,977,088 (GRCm39) N112K probably damaging Het
Rgs22 A G 15: 36,082,057 (GRCm39) probably null Het
Rps23rg1 A G 8: 3,630,452 (GRCm39) probably benign Het
Rps26 C T 10: 128,461,995 (GRCm39) V40I probably benign Het
Runx2 A T 17: 44,919,123 (GRCm39) M405K probably damaging Het
Serinc2 A C 4: 130,169,280 (GRCm39) C4G unknown Het
Sh3rf2 C A 18: 42,244,235 (GRCm39) R266S probably benign Het
Slc38a10 A G 11: 120,007,822 (GRCm39) I386T possibly damaging Het
Stab2 G A 10: 86,708,483 (GRCm39) P1694L probably benign Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tasor G T 14: 27,198,600 (GRCm39) G1311C probably damaging Het
Tmem102 A G 11: 69,695,171 (GRCm39) V267A probably damaging Het
Trim65 A G 11: 116,021,755 (GRCm39) L26P probably damaging Het
Vmn1r160 T A 7: 22,571,379 (GRCm39) M244K possibly damaging Het
Vmn1r57 A T 7: 5,224,138 (GRCm39) H221L probably benign Het
Wdr89 C A 12: 75,679,673 (GRCm39) V194F probably damaging Het
Wee1 C A 7: 109,730,085 (GRCm39) Y396* probably null Het
Zfp451 A T 1: 33,812,060 (GRCm39) V885D probably damaging Het
Zfp981 A T 4: 146,622,333 (GRCm39) Q419H probably benign Het
Znfx1 A G 2: 166,881,747 (GRCm39) Y1081H probably damaging Het
Other mutations in Ihh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ihh APN 1 74,985,601 (GRCm39) missense probably damaging 1.00
IGL02174:Ihh APN 1 74,990,105 (GRCm39) missense probably damaging 0.98
Echidna UTSW 1 74,985,886 (GRCm39) missense probably benign 0.08
R0047:Ihh UTSW 1 74,985,750 (GRCm39) missense probably benign 0.01
R0047:Ihh UTSW 1 74,985,750 (GRCm39) missense probably benign 0.01
R1404:Ihh UTSW 1 74,990,372 (GRCm39) start codon destroyed probably null
R1404:Ihh UTSW 1 74,990,372 (GRCm39) start codon destroyed probably null
R2936:Ihh UTSW 1 74,985,705 (GRCm39) missense probably damaging 0.97
R4520:Ihh UTSW 1 74,990,109 (GRCm39) missense probably damaging 1.00
R4540:Ihh UTSW 1 74,987,558 (GRCm39) missense possibly damaging 0.94
R5399:Ihh UTSW 1 74,985,436 (GRCm39) missense probably benign 0.00
R5736:Ihh UTSW 1 74,985,286 (GRCm39) missense probably benign
R6026:Ihh UTSW 1 74,985,886 (GRCm39) missense probably benign 0.08
R6073:Ihh UTSW 1 74,990,438 (GRCm39) utr 5 prime probably benign
R6458:Ihh UTSW 1 74,985,601 (GRCm39) missense probably damaging 1.00
R6489:Ihh UTSW 1 74,985,670 (GRCm39) missense probably damaging 1.00
R7311:Ihh UTSW 1 74,990,306 (GRCm39) missense unknown
R7350:Ihh UTSW 1 74,987,492 (GRCm39) missense probably damaging 1.00
R7818:Ihh UTSW 1 74,985,804 (GRCm39) missense possibly damaging 0.84
R9128:Ihh UTSW 1 74,985,498 (GRCm39) missense probably damaging 1.00
Z1176:Ihh UTSW 1 74,985,253 (GRCm39) missense probably damaging 1.00
Z1189:Ihh UTSW 1 74,990,204 (GRCm39) missense probably damaging 1.00
Z1192:Ihh UTSW 1 74,990,204 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGGTGCTCTCTTCTAGC -3'
(R):5'- ATCGAGACTCAGGATCCTCC -3'

Sequencing Primer
(F):5'- TCTTCTAGCAAGAGACGCCC -3'
(R):5'- ACTCAGGATCCTCCGCGTC -3'
Posted On 2019-12-20