Incidental Mutation 'R7835:Accsl'
ID 605900
Institutional Source Beutler Lab
Gene Symbol Accsl
Ensembl Gene ENSMUSG00000075023
Gene Name 1-aminocyclopropane-1-carboxylate synthase (inactive)-like
Synonyms
MMRRC Submission 045889-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7835 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 93685706-93699502 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 93696329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 90 (K90*)
Ref Sequence ENSEMBL: ENSMUSP00000097281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099690] [ENSMUST00000133562] [ENSMUST00000143033]
AlphaFold Q3UX83
Predicted Effect probably null
Transcript: ENSMUST00000099690
AA Change: K90*
SMART Domains Protein: ENSMUSP00000097281
Gene: ENSMUSG00000075023
AA Change: K90*

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Pfam:Aminotran_1_2 190 568 6.9e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133562
AA Change: K94*
SMART Domains Protein: ENSMUSP00000120924
Gene: ENSMUSG00000075023
AA Change: K94*

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000143033
AA Change: K94*
SMART Domains Protein: ENSMUSP00000118053
Gene: ENSMUSG00000075023
AA Change: K94*

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 78,749,623 (GRCm39) S1465T probably benign Het
Adamts3 A T 5: 89,848,299 (GRCm39) D674E possibly damaging Het
Adap2 T A 11: 80,051,057 (GRCm39) V129D probably benign Het
Ank3 A G 10: 69,823,557 (GRCm39) D742G Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cachd1 G T 4: 100,831,350 (GRCm39) probably null Het
Ccne1 G T 7: 37,802,270 (GRCm39) Q133K probably benign Het
Cers3 C T 7: 66,423,387 (GRCm39) H111Y possibly damaging Het
Chst5 A T 8: 112,617,234 (GRCm39) L129M probably damaging Het
Depdc7 A G 2: 104,558,530 (GRCm39) S164P probably benign Het
Dnah10 G A 5: 124,854,298 (GRCm39) A1966T probably damaging Het
Fcgbp T G 7: 27,816,632 (GRCm39) S2365A possibly damaging Het
Ihh A G 1: 74,985,525 (GRCm39) V320A probably damaging Het
Kdm5d T C Y: 900,558 (GRCm39) V201A possibly damaging Het
Kif13b T A 14: 65,004,901 (GRCm39) H1117Q probably benign Het
Lcn8 C A 2: 25,545,308 (GRCm39) probably null Het
Lrp4 T C 2: 91,325,387 (GRCm39) V1404A possibly damaging Het
Lrrc61 A T 6: 48,545,506 (GRCm39) T110S probably benign Het
Mrpl19 G A 6: 81,939,107 (GRCm39) R232C probably damaging Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Mzt1 T C 14: 99,283,439 (GRCm39) T21A probably benign Het
Naip6 G T 13: 100,452,512 (GRCm39) A183E probably benign Het
Neb T C 2: 52,040,589 (GRCm39) D6624G probably benign Het
Nup85 A G 11: 115,460,897 (GRCm39) D183G probably benign Het
Olfm5 A T 7: 103,803,652 (GRCm39) Y195* probably null Het
Or7g16 T A 9: 18,727,105 (GRCm39) M162L probably benign Het
Piezo2 A T 18: 63,216,016 (GRCm39) F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Polr1a T C 6: 71,892,126 (GRCm39) V135A probably benign Het
Ppcdc A G 9: 57,327,559 (GRCm39) S83P probably benign Het
Prss21 A T 17: 24,088,425 (GRCm39) Q130L possibly damaging Het
Rdx T A 9: 51,977,088 (GRCm39) N112K probably damaging Het
Rgs22 A G 15: 36,082,057 (GRCm39) probably null Het
Rps23rg1 A G 8: 3,630,452 (GRCm39) probably benign Het
Rps26 C T 10: 128,461,995 (GRCm39) V40I probably benign Het
Runx2 A T 17: 44,919,123 (GRCm39) M405K probably damaging Het
Serinc2 A C 4: 130,169,280 (GRCm39) C4G unknown Het
Sh3rf2 C A 18: 42,244,235 (GRCm39) R266S probably benign Het
Slc38a10 A G 11: 120,007,822 (GRCm39) I386T possibly damaging Het
Stab2 G A 10: 86,708,483 (GRCm39) P1694L probably benign Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tasor G T 14: 27,198,600 (GRCm39) G1311C probably damaging Het
Tmem102 A G 11: 69,695,171 (GRCm39) V267A probably damaging Het
Trim65 A G 11: 116,021,755 (GRCm39) L26P probably damaging Het
Vmn1r160 T A 7: 22,571,379 (GRCm39) M244K possibly damaging Het
Vmn1r57 A T 7: 5,224,138 (GRCm39) H221L probably benign Het
Wdr89 C A 12: 75,679,673 (GRCm39) V194F probably damaging Het
Wee1 C A 7: 109,730,085 (GRCm39) Y396* probably null Het
Zfp451 A T 1: 33,812,060 (GRCm39) V885D probably damaging Het
Zfp981 A T 4: 146,622,333 (GRCm39) Q419H probably benign Het
Znfx1 A G 2: 166,881,747 (GRCm39) Y1081H probably damaging Het
Other mutations in Accsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Accsl APN 2 93,696,253 (GRCm39) missense possibly damaging 0.46
IGL02511:Accsl APN 2 93,692,111 (GRCm39) unclassified probably benign
IGL03248:Accsl APN 2 93,693,129 (GRCm39) unclassified probably benign
IGL03338:Accsl APN 2 93,686,092 (GRCm39) missense probably benign 0.34
R0323:Accsl UTSW 2 93,691,425 (GRCm39) missense probably benign 0.27
R0449:Accsl UTSW 2 93,696,419 (GRCm39) missense probably benign 0.00
R1172:Accsl UTSW 2 93,696,589 (GRCm39) splice site probably benign
R1173:Accsl UTSW 2 93,696,589 (GRCm39) splice site probably benign
R1175:Accsl UTSW 2 93,696,589 (GRCm39) splice site probably benign
R1752:Accsl UTSW 2 93,688,375 (GRCm39) missense probably damaging 1.00
R1952:Accsl UTSW 2 93,689,778 (GRCm39) missense probably damaging 1.00
R2877:Accsl UTSW 2 93,689,755 (GRCm39) missense probably damaging 0.99
R2878:Accsl UTSW 2 93,689,755 (GRCm39) missense probably damaging 0.99
R4472:Accsl UTSW 2 93,694,337 (GRCm39) splice site probably null
R4472:Accsl UTSW 2 93,694,336 (GRCm39) critical splice acceptor site probably null
R5400:Accsl UTSW 2 93,689,767 (GRCm39) missense probably damaging 0.99
R5502:Accsl UTSW 2 93,687,289 (GRCm39) critical splice donor site probably null
R5610:Accsl UTSW 2 93,692,118 (GRCm39) critical splice donor site probably null
R5636:Accsl UTSW 2 93,699,370 (GRCm39) missense probably benign 0.41
R5799:Accsl UTSW 2 93,694,748 (GRCm39) splice site probably null
R6376:Accsl UTSW 2 93,687,343 (GRCm39) missense probably damaging 1.00
R6913:Accsl UTSW 2 93,696,488 (GRCm39) missense possibly damaging 0.66
R7311:Accsl UTSW 2 93,696,160 (GRCm39) missense possibly damaging 0.51
R7564:Accsl UTSW 2 93,688,501 (GRCm39) missense possibly damaging 0.83
R7731:Accsl UTSW 2 93,691,363 (GRCm39) missense probably benign 0.01
R8184:Accsl UTSW 2 93,686,086 (GRCm39) missense probably benign 0.19
R8305:Accsl UTSW 2 93,696,423 (GRCm39) missense probably benign 0.00
R8824:Accsl UTSW 2 93,693,195 (GRCm39) missense probably damaging 1.00
R8868:Accsl UTSW 2 93,696,490 (GRCm39) missense probably benign 0.00
R8954:Accsl UTSW 2 93,688,299 (GRCm39) missense probably benign 0.06
R9172:Accsl UTSW 2 93,691,833 (GRCm39) missense probably damaging 1.00
R9473:Accsl UTSW 2 93,686,092 (GRCm39) missense probably benign 0.03
R9513:Accsl UTSW 2 93,699,498 (GRCm39) unclassified probably benign
Z1088:Accsl UTSW 2 93,696,293 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGACTCATAGATGCCAGCCC -3'
(R):5'- GACTCAGGGATCAGCTGAAG -3'

Sequencing Primer
(F):5'- CGCTTAGATAGGGTGCAGC -3'
(R):5'- TCAGCTGAAGAAGAAGTCCTC -3'
Posted On 2019-12-20