Incidental Mutation 'R7835:Accsl'
ID605900
Institutional Source Beutler Lab
Gene Symbol Accsl
Ensembl Gene ENSMUSG00000075023
Gene Name1-aminocyclopropane-1-carboxylate synthase (non-functional)-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location93855361-93869157 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 93865984 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 90 (K90*)
Ref Sequence ENSEMBL: ENSMUSP00000097281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099690] [ENSMUST00000133562] [ENSMUST00000143033]
Predicted Effect probably null
Transcript: ENSMUST00000099690
AA Change: K90*
SMART Domains Protein: ENSMUSP00000097281
Gene: ENSMUSG00000075023
AA Change: K90*

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Pfam:Aminotran_1_2 190 568 6.9e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133562
AA Change: K94*
SMART Domains Protein: ENSMUSP00000120924
Gene: ENSMUSG00000075023
AA Change: K94*

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000143033
AA Change: K94*
SMART Domains Protein: ENSMUSP00000118053
Gene: ENSMUSG00000075023
AA Change: K94*

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Accsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Accsl APN 2 93865908 missense possibly damaging 0.46
IGL02511:Accsl APN 2 93861766 unclassified probably benign
IGL03248:Accsl APN 2 93862784 unclassified probably benign
IGL03338:Accsl APN 2 93855747 missense probably benign 0.34
R0323:Accsl UTSW 2 93861080 missense probably benign 0.27
R0449:Accsl UTSW 2 93866074 missense probably benign 0.00
R1172:Accsl UTSW 2 93866244 splice site probably benign
R1173:Accsl UTSW 2 93866244 splice site probably benign
R1175:Accsl UTSW 2 93866244 splice site probably benign
R1752:Accsl UTSW 2 93858030 missense probably damaging 1.00
R1952:Accsl UTSW 2 93859433 missense probably damaging 1.00
R2877:Accsl UTSW 2 93859410 missense probably damaging 0.99
R2878:Accsl UTSW 2 93859410 missense probably damaging 0.99
R4472:Accsl UTSW 2 93863991 critical splice acceptor site probably null
R4472:Accsl UTSW 2 93863992 splice site probably null
R5400:Accsl UTSW 2 93859422 missense probably damaging 0.99
R5502:Accsl UTSW 2 93856944 critical splice donor site probably null
R5610:Accsl UTSW 2 93861773 critical splice donor site probably null
R5636:Accsl UTSW 2 93869025 missense probably benign 0.41
R5799:Accsl UTSW 2 93864403 splice site probably null
R6376:Accsl UTSW 2 93856998 missense probably damaging 1.00
R6913:Accsl UTSW 2 93866143 missense possibly damaging 0.66
R7311:Accsl UTSW 2 93865815 missense possibly damaging 0.51
R7564:Accsl UTSW 2 93858156 missense possibly damaging 0.83
R7731:Accsl UTSW 2 93861018 missense probably benign 0.01
R8184:Accsl UTSW 2 93855741 missense probably benign 0.19
R8305:Accsl UTSW 2 93866078 missense probably benign 0.00
Z1088:Accsl UTSW 2 93865948 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGACTCATAGATGCCAGCCC -3'
(R):5'- GACTCAGGGATCAGCTGAAG -3'

Sequencing Primer
(F):5'- CGCTTAGATAGGGTGCAGC -3'
(R):5'- TCAGCTGAAGAAGAAGTCCTC -3'
Posted On2019-12-20