Mutagenetix > Incidental Mutation

Incidental Mutation 'R7835:Znfx1'

605902

Institutional Source

Beutler Lab

Gene Symbol

Znfx1

Ensembl Gene

ENSMUSG00000039501

Gene Name

zinc finger, NFX1-type containing 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7835 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

167035793-167063015 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 167039827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1081 (Y1081H)

Ref Sequence

ENSEMBL: ENSMUSP00000049404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018143] [ENSMUST00000048988] [ENSMUST00000067584] [ENSMUST00000128676] [ENSMUST00000155281]

AlphaFold

Q8R151

Predicted Effect

probably benign
Transcript: ENSMUST00000018143

SMART Domains

Protein: ENSMUSP00000018143
Gene: ENSMUSG00000017999

Domain	Start	End	E-Value	Type
low complexity region	20	33	N/A	INTRINSIC
coiled coil region	78	106	N/A	INTRINSIC
low complexity region	133	148	N/A	INTRINSIC
low complexity region	157	166	N/A	INTRINSIC
DEXDc	203	404	2.24e-56	SMART
HELICc	443	524	1.71e-29	SMART
coiled coil region	577	613	N/A	INTRINSIC
low complexity region	622	629	N/A	INTRINSIC
low complexity region	644	657	N/A	INTRINSIC
low complexity region	679	692	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000048988
AA Change: Y1081H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501
AA Change: Y1081H

Domain	Start	End	E-Value	Type
Pfam:AAA_11	590	855	2.2e-17	PFAM
Pfam:AAA_19	597	684	1.7e-10	PFAM
Pfam:AAA_11	829	1033	1.4e-18	PFAM
Pfam:AAA_12	1044	1228	3.7e-42	PFAM
internal_repeat_2	1281	1374	1.33e-7	PROSPERO
internal_repeat_1	1292	1410	1.32e-16	PROSPERO
low complexity region	1422	1433	N/A	INTRINSIC
internal_repeat_1	1434	1547	1.32e-16	PROSPERO
internal_repeat_2	1453	1555	1.33e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000067584
AA Change: Y217H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072867
Gene: ENSMUSG00000039501
AA Change: Y217H

Domain	Start	End	E-Value	Type
Pfam:AAA_11	8	170	1.2e-17	PFAM
Pfam:AAA_12	180	364	7.4e-42	PFAM
internal_repeat_2	417	510	1.08e-6	PROSPERO
internal_repeat_1	428	546	1.81e-14	PROSPERO
low complexity region	558	569	N/A	INTRINSIC
internal_repeat_1	570	683	1.81e-14	PROSPERO
internal_repeat_2	589	691	1.08e-6	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000128676

SMART Domains

Protein: ENSMUSP00000121598
Gene: ENSMUSG00000039501

Domain	Start	End	E-Value	Type
Pfam:AAA_11	590	837	1.8e-17	PFAM
Pfam:AAA_19	597	684	3.4e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155281

SMART Domains

Protein: ENSMUSP00000121750
Gene: ENSMUSG00000039501

Domain	Start	End	E-Value	Type
Pfam:AAA_11	590	854	1.7e-17	PFAM
Pfam:AAA_19	597	684	3.6e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (48/49)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	A	7: 79,099,875	S1465T	probably benign	Het
Accsl	T	A	2: 93,865,984	K90*	probably null	Het
Adamts3	A	T	5: 89,700,440	D674E	possibly damaging	Het
Adap2	T	A	11: 80,160,231	V129D	probably benign	Het
Ank3	A	G	10: 69,987,727	D742G		Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C330021F23Rik	A	G	8: 3,580,452		probably benign	Het
Cachd1	G	T	4: 100,974,153		probably null	Het
Ccne1	G	T	7: 38,102,845	Q133K	probably benign	Het
Cers3	C	T	7: 66,773,639	H111Y	possibly damaging	Het
Chst5	A	T	8: 111,890,602	L129M	probably damaging	Het
Depdc7	A	G	2: 104,728,185	S164P	probably benign	Het
Dnah10	G	A	5: 124,777,234	A1966T	probably damaging	Het
Fam208a	G	T	14: 27,476,643	G1311C	probably damaging	Het
Fcgbp	T	G	7: 28,117,207	S2365A	possibly damaging	Het
Ihh	A	G	1: 74,946,366	V320A	probably damaging	Het
Kdm5d	T	C	Y: 900,558	V201A	possibly damaging	Het
Kif13b	T	A	14: 64,767,452	H1117Q	probably benign	Het
Lcn8	C	A	2: 25,655,296		probably null	Het
Lrp4	T	C	2: 91,495,042	V1404A	possibly damaging	Het
Lrrc61	A	T	6: 48,568,572	T110S	probably benign	Het
Mrpl19	G	A	6: 81,962,126	R232C	probably damaging	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Mzt1	T	C	14: 99,046,003	T21A	probably benign	Het
Naip6	G	T	13: 100,316,004	A183E	probably benign	Het
Neb	T	C	2: 52,150,577	D6624G	probably benign	Het
Nup85	A	G	11: 115,570,071	D183G	probably benign	Het
Olfm5	A	T	7: 104,154,445	Y195*	probably null	Het
Olfr828	T	A	9: 18,815,809	M162L	probably benign	Het
Piezo2	A	T	18: 63,082,945	F1216I	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Polr1a	T	C	6: 71,915,142	V135A	probably benign	Het
Ppcdc	A	G	9: 57,420,276	S83P	probably benign	Het
Prss21	A	T	17: 23,869,451	Q130L	possibly damaging	Het
Rdx	T	A	9: 52,065,788	N112K	probably damaging	Het
Rgs22	A	G	15: 36,081,911		probably null	Het
Rps26	C	T	10: 128,626,126	V40I	probably benign	Het
Runx2	A	T	17: 44,608,236	M405K	probably damaging	Het
Serinc2	A	C	4: 130,275,487	C4G	unknown	Het
Sh3rf2	C	A	18: 42,111,170	R266S	probably benign	Het
Slc38a10	A	G	11: 120,116,996	I386T	possibly damaging	Het
Stab2	G	A	10: 86,872,619	P1694L	probably benign	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tmem102	A	G	11: 69,804,345	V267A	probably damaging	Het
Trim65	A	G	11: 116,130,929	L26P	probably damaging	Het
Vmn1r160	T	A	7: 22,871,954	M244K	possibly damaging	Het
Vmn1r57	A	T	7: 5,221,139	H221L	probably benign	Het
Wdr89	C	A	12: 75,632,899	V194F	probably damaging	Het
Wee1	C	A	7: 110,130,878	Y396*	probably null	Het
Zfp451	A	T	1: 33,772,979	V885D	probably damaging	Het
Zfp981	A	T	4: 146,537,876	Q419H	probably benign	Het

Other mutations in Znfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Znfx1	APN	2	167036729	missense	possibly damaging	0.65
IGL00492:Znfx1	APN	2	167036923	missense	probably damaging	1.00
IGL01285:Znfx1	APN	2	167038695	missense	possibly damaging	0.76
IGL01343:Znfx1	APN	2	167037363	missense	probably benign	0.16
IGL01767:Znfx1	APN	2	167055723	missense	probably damaging	1.00
IGL01983:Znfx1	APN	2	167056350	missense	probably damaging	1.00
IGL02006:Znfx1	APN	2	167055763	missense	probably damaging	1.00
IGL02254:Znfx1	APN	2	167055723	missense	probably damaging	1.00
IGL02421:Znfx1	APN	2	167060080	missense	probably damaging	0.97
IGL02496:Znfx1	APN	2	167047630	missense	possibly damaging	0.83
IGL02525:Znfx1	APN	2	167037537	missense	probably benign	0.00
IGL02528:Znfx1	APN	2	167050404	missense	probably benign	0.11
IGL02537:Znfx1	APN	2	167056167	missense	probably benign	0.37
IGL03065:Znfx1	APN	2	167055765	missense	probably benign	0.00
R0127:Znfx1	UTSW	2	167044210	missense	possibly damaging	0.84
R0331:Znfx1	UTSW	2	167046978	missense	probably benign	0.11
R0488:Znfx1	UTSW	2	167042563	missense	possibly damaging	0.52
R0497:Znfx1	UTSW	2	167055411	missense	probably benign	0.03
R0537:Znfx1	UTSW	2	167041701	missense	probably damaging	1.00
R0542:Znfx1	UTSW	2	167055655	missense	probably damaging	1.00
R0650:Znfx1	UTSW	2	167047654	nonsense	probably null
R0655:Znfx1	UTSW	2	167056907	missense	probably damaging	1.00
R1104:Znfx1	UTSW	2	167055640	nonsense	probably null
R1470:Znfx1	UTSW	2	167042587	missense	possibly damaging	0.91
R1470:Znfx1	UTSW	2	167042587	missense	possibly damaging	0.91
R1512:Znfx1	UTSW	2	167056317	missense	probably benign	0.03
R1533:Znfx1	UTSW	2	167056788	missense	probably benign	0.10
R1541:Znfx1	UTSW	2	167056190	missense	probably damaging	0.99
R1642:Znfx1	UTSW	2	167039010	missense	possibly damaging	0.95
R1720:Znfx1	UTSW	2	167044066	nonsense	probably null
R1760:Znfx1	UTSW	2	167039866	missense	probably damaging	0.96
R1865:Znfx1	UTSW	2	167038809	missense	probably damaging	1.00
R1959:Znfx1	UTSW	2	167050350	missense	probably damaging	1.00
R2088:Znfx1	UTSW	2	167055810	missense	probably damaging	1.00
R4581:Znfx1	UTSW	2	167050316	missense	probably damaging	1.00
R4622:Znfx1	UTSW	2	167041753	missense	possibly damaging	0.91
R4649:Znfx1	UTSW	2	167056356	missense	probably benign	0.08
R4685:Znfx1	UTSW	2	167039030	missense	probably damaging	1.00
R4798:Znfx1	UTSW	2	167038569	splice site	probably null
R4827:Znfx1	UTSW	2	167044231	missense	possibly damaging	0.77
R4870:Znfx1	UTSW	2	167055269	missense	probably benign
R4910:Znfx1	UTSW	2	167036804	missense	probably damaging	1.00
R4910:Znfx1	UTSW	2	167037482	missense	probably benign	0.00
R5022:Znfx1	UTSW	2	167039826	missense	probably damaging	1.00
R5023:Znfx1	UTSW	2	167039826	missense	probably damaging	1.00
R5057:Znfx1	UTSW	2	167039826	missense	probably damaging	1.00
R5061:Znfx1	UTSW	2	167065398	unclassified	probably benign
R5119:Znfx1	UTSW	2	167065387	unclassified	probably benign
R5125:Znfx1	UTSW	2	167046939	missense	possibly damaging	0.81
R5896:Znfx1	UTSW	2	167039000	missense	probably damaging	1.00
R6107:Znfx1	UTSW	2	167037081	missense	possibly damaging	0.67
R6112:Znfx1	UTSW	2	167038206	missense	probably benign
R6158:Znfx1	UTSW	2	167056726	missense	probably benign	0.19
R6281:Znfx1	UTSW	2	167055885	missense	probably damaging	1.00
R6464:Znfx1	UTSW	2	167046922	missense	probably benign	0.34
R6749:Znfx1	UTSW	2	167056599	missense	probably benign	0.00
R6888:Znfx1	UTSW	2	167038940	missense	possibly damaging	0.91
R6973:Znfx1	UTSW	2	167056761	missense	probably benign	0.18
R7017:Znfx1	UTSW	2	167048534	missense	probably damaging	1.00
R7138:Znfx1	UTSW	2	167056777	missense	probably benign	0.03
R7192:Znfx1	UTSW	2	167042190	missense	probably benign	0.00
R7426:Znfx1	UTSW	2	167048555	missense	probably damaging	1.00
R7431:Znfx1	UTSW	2	167055792	missense	probably damaging	1.00
R7473:Znfx1	UTSW	2	167038824	missense	probably damaging	1.00
R7593:Znfx1	UTSW	2	167056225	missense	probably benign	0.28
R7732:Znfx1	UTSW	2	167042669	missense	possibly damaging	0.91
R7993:Znfx1	UTSW	2	167055937	nonsense	probably null
R8154:Znfx1	UTSW	2	167055237	missense	probably damaging	1.00
R8351:Znfx1	UTSW	2	167055655	missense	probably damaging	1.00
R8790:Znfx1	UTSW	2	167050580	intron	probably benign
R8953:Znfx1	UTSW	2	167055501	missense	probably damaging	1.00
R9005:Znfx1	UTSW	2	167038736	missense
R9131:Znfx1	UTSW	2	167050378	missense	probably benign
R9163:Znfx1	UTSW	2	167056341	missense	probably damaging	1.00
R9169:Znfx1	UTSW	2	167055265	missense	probably benign
R9181:Znfx1	UTSW	2	167037818	missense	probably damaging	1.00
R9181:Znfx1	UTSW	2	167038217	missense	probably benign	0.06
R9300:Znfx1	UTSW	2	167055940	missense	probably damaging	1.00
R9448:Znfx1	UTSW	2	167046924	missense	probably benign	0.04
R9569:Znfx1	UTSW	2	167055955	missense	not run
X0064:Znfx1	UTSW	2	167055256	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAGCACCAGCATCTCTTG -3'
(R):5'- AGCCTCTTGCATCATGGTTTG -3'

Sequencing Primer
(F):5'- TCATTCAGGGTCACACAGCTG -3'
(R):5'- TGCATCATGGTTTGTCCCAG -3'

Posted On

2019-12-20