Mutagenetix > Incidental Mutation

Incidental Mutation 'R7835:Taf4'

605903

Institutional Source

Beutler Lab

Gene Symbol

Taf4

Ensembl Gene

ENSMUSG00000039117

Gene Name

TATA-box binding protein associated factor 4

Synonyms

Taf4a, Taf2c1, TAFII130, TAFII135

MMRRC Submission

045889-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7835 (G1)

Quality Score

117.008

Status

Validated

Chromosome

Chromosomal Location

179912152-179976646 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 179932029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 682 (T682M)

Ref Sequence

ENSEMBL: ENSMUSP00000153863 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]

AlphaFold

E9QAP7

Predicted Effect

probably damaging
Transcript: ENSMUST00000041618
AA Change: T682M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: T682M

Domain	Start	End	E-Value	Type
low complexity region	28	44	N/A	INTRINSIC
low complexity region	64	181	N/A	INTRINSIC
SCOP:d1hqva_	312	325	6e-3	SMART
low complexity region	339	371	N/A	INTRINSIC
low complexity region	395	408	N/A	INTRINSIC
low complexity region	428	443	N/A	INTRINSIC
low complexity region	445	458	N/A	INTRINSIC
internal_repeat_1	465	500	2.85e-5	PROSPERO
low complexity region	537	547	N/A	INTRINSIC
TAFH	550	642	4.9e-54	SMART
internal_repeat_1	692	727	2.85e-5	PROSPERO
low complexity region	767	773	N/A	INTRINSIC
Pfam:TAF4	791	1039	3.5e-81	PFAM

Predicted Effect

not run
Transcript: ENSMUST00000131358
AA Change: T319M

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154961

Predicted Effect

probably damaging
Transcript: ENSMUST00000227325
AA Change: T682M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.2230

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	A	7: 79,099,875	S1465T	probably benign	Het
Accsl	T	A	2: 93,865,984	K90*	probably null	Het
Adamts3	A	T	5: 89,700,440	D674E	possibly damaging	Het
Adap2	T	A	11: 80,160,231	V129D	probably benign	Het
Ank3	A	G	10: 69,987,727	D742G		Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C330021F23Rik	A	G	8: 3,580,452		probably benign	Het
Cachd1	G	T	4: 100,974,153		probably null	Het
Ccne1	G	T	7: 38,102,845	Q133K	probably benign	Het
Cers3	C	T	7: 66,773,639	H111Y	possibly damaging	Het
Chst5	A	T	8: 111,890,602	L129M	probably damaging	Het
Depdc7	A	G	2: 104,728,185	S164P	probably benign	Het
Dnah10	G	A	5: 124,777,234	A1966T	probably damaging	Het
Fam208a	G	T	14: 27,476,643	G1311C	probably damaging	Het
Fcgbp	T	G	7: 28,117,207	S2365A	possibly damaging	Het
Ihh	A	G	1: 74,946,366	V320A	probably damaging	Het
Kdm5d	T	C	Y: 900,558	V201A	possibly damaging	Het
Kif13b	T	A	14: 64,767,452	H1117Q	probably benign	Het
Lcn8	C	A	2: 25,655,296		probably null	Het
Lrp4	T	C	2: 91,495,042	V1404A	possibly damaging	Het
Lrrc61	A	T	6: 48,568,572	T110S	probably benign	Het
Mrpl19	G	A	6: 81,962,126	R232C	probably damaging	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Mzt1	T	C	14: 99,046,003	T21A	probably benign	Het
Naip6	G	T	13: 100,316,004	A183E	probably benign	Het
Neb	T	C	2: 52,150,577	D6624G	probably benign	Het
Nup85	A	G	11: 115,570,071	D183G	probably benign	Het
Olfm5	A	T	7: 104,154,445	Y195*	probably null	Het
Olfr828	T	A	9: 18,815,809	M162L	probably benign	Het
Piezo2	A	T	18: 63,082,945	F1216I	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Polr1a	T	C	6: 71,915,142	V135A	probably benign	Het
Ppcdc	A	G	9: 57,420,276	S83P	probably benign	Het
Prss21	A	T	17: 23,869,451	Q130L	possibly damaging	Het
Rdx	T	A	9: 52,065,788	N112K	probably damaging	Het
Rgs22	A	G	15: 36,081,911		probably null	Het
Rps26	C	T	10: 128,626,126	V40I	probably benign	Het
Runx2	A	T	17: 44,608,236	M405K	probably damaging	Het
Serinc2	A	C	4: 130,275,487	C4G	unknown	Het
Sh3rf2	C	A	18: 42,111,170	R266S	probably benign	Het
Slc38a10	A	G	11: 120,116,996	I386T	possibly damaging	Het
Stab2	G	A	10: 86,872,619	P1694L	probably benign	Het
Tmem102	A	G	11: 69,804,345	V267A	probably damaging	Het
Trim65	A	G	11: 116,130,929	L26P	probably damaging	Het
Vmn1r160	T	A	7: 22,871,954	M244K	possibly damaging	Het
Vmn1r57	A	T	7: 5,221,139	H221L	probably benign	Het
Wdr89	C	A	12: 75,632,899	V194F	probably damaging	Het
Wee1	C	A	7: 110,130,878	Y396*	probably null	Het
Zfp451	A	T	1: 33,772,979	V885D	probably damaging	Het
Zfp981	A	T	4: 146,537,876	Q419H	probably benign	Het
Znfx1	A	G	2: 167,039,827	Y1081H	probably damaging	Het

Other mutations in Taf4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Taf4	APN	2	179976625	missense	unknown
IGL00517:Taf4	APN	2	179924413	splice site	probably benign
IGL02159:Taf4	APN	2	179938470	missense	probably benign	0.24
IGL02254:Taf4	APN	2	179921184	missense	probably benign	0.25
IGL03366:Taf4	APN	2	179935054	missense	probably damaging	1.00
R0049:Taf4	UTSW	2	179924091	missense	probably damaging	0.98
R0049:Taf4	UTSW	2	179924091	missense	probably damaging	0.98
R1267:Taf4	UTSW	2	179929324	missense	possibly damaging	0.46
R1495:Taf4	UTSW	2	179933027	missense	probably damaging	1.00
R1560:Taf4	UTSW	2	179935953	missense	probably benign	0.14
R1756:Taf4	UTSW	2	179976531	missense	unknown
R1893:Taf4	UTSW	2	179933030	missense	probably damaging	0.98
R1932:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R2213:Taf4	UTSW	2	179935890	critical splice donor site	probably null
R3896:Taf4	UTSW	2	179932014	missense	probably benign	0.45
R4050:Taf4	UTSW	2	179932012	missense	probably damaging	1.00
R4448:Taf4	UTSW	2	179935971	missense	possibly damaging	0.65
R4736:Taf4	UTSW	2	179924494	missense	probably damaging	1.00
R5124:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R6155:Taf4	UTSW	2	179913524	missense	probably damaging	1.00
R6238:Taf4	UTSW	2	179932039	missense	probably damaging	0.97
R6292:Taf4	UTSW	2	179923987	missense	probably damaging	1.00
R7749:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R7751:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R7752:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R7754:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R7879:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R7880:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R7880:Taf4	UTSW	2	179935933	nonsense	probably null
R7883:Taf4	UTSW	2	179929295	missense	probably damaging	1.00
R7899:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R7902:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R7905:Taf4	UTSW	2	179932029	missense	probably damaging	1.00
R9743:Taf4	UTSW	2	179939799	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- ACACGTCTTTCCAGCAGGAG -3'
(R):5'- AATGTTCCAGCTGTGCCTGAC -3'

Sequencing Primer
(F):5'- GGAGCTTCCTTGCCTGC -3'
(R):5'- AGCTTACCTGCCTTGAGACAG -3'

Posted On

2019-12-20