Incidental Mutation 'R7835:Zfp981'
ID 605905
Institutional Source Beutler Lab
Gene Symbol Zfp981
Ensembl Gene ENSMUSG00000056300
Gene Name zinc finger protein 981
Synonyms Gm13247
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R7835 (G1)
Quality Score 131.008
Status Validated
Chromosome 4
Chromosomal Location 146502027-146539395 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 146537876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 419 (Q419H)
Ref Sequence ENSEMBL: ENSMUSP00000101361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105735] [ENSMUST00000140089] [ENSMUST00000179175]
AlphaFold A2A8V7
Predicted Effect probably benign
Transcript: ENSMUST00000105735
AA Change: Q419H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101361
Gene: ENSMUSG00000056300
AA Change: Q419H

DomainStartEndE-ValueType
KRAB 13 73 2.34e-15 SMART
ZnF_C2H2 239 261 7.9e-4 SMART
ZnF_C2H2 267 289 8.6e-5 SMART
ZnF_C2H2 295 317 8.6e-5 SMART
ZnF_C2H2 323 345 1.36e-2 SMART
ZnF_C2H2 351 373 6.32e-3 SMART
ZnF_C2H2 379 401 8.6e-5 SMART
ZnF_C2H2 407 429 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140089
SMART Domains Protein: ENSMUSP00000115886
Gene: ENSMUSG00000056300

DomainStartEndE-ValueType
KRAB 13 73 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179175
AA Change: Q419H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000136739
Gene: ENSMUSG00000056300
AA Change: Q419H

DomainStartEndE-ValueType
KRAB 13 73 2.34e-15 SMART
ZnF_C2H2 239 261 7.9e-4 SMART
ZnF_C2H2 267 289 8.6e-5 SMART
ZnF_C2H2 295 317 8.6e-5 SMART
ZnF_C2H2 323 345 1.36e-2 SMART
ZnF_C2H2 351 373 6.32e-3 SMART
ZnF_C2H2 379 401 8.6e-5 SMART
ZnF_C2H2 407 429 3.11e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Zfp981
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02647:Zfp981 APN 4 146537252 nonsense probably null
R0003:Zfp981 UTSW 4 146537760 missense probably damaging 1.00
R1172:Zfp981 UTSW 4 146537764 missense probably benign
R2989:Zfp981 UTSW 4 146537890 missense probably benign 0.40
R4158:Zfp981 UTSW 4 146537623 missense probably benign
R4158:Zfp981 UTSW 4 146537882 missense probably benign 0.07
R4778:Zfp981 UTSW 4 146537655 missense probably benign
R5148:Zfp981 UTSW 4 146536900 missense possibly damaging 0.86
R5352:Zfp981 UTSW 4 146537005 missense probably benign 0.29
R6252:Zfp981 UTSW 4 146537513 missense probably benign 0.22
R6674:Zfp981 UTSW 4 146535493 missense probably damaging 0.98
R6765:Zfp981 UTSW 4 146537906 missense probably benign 0.34
R7288:Zfp981 UTSW 4 146537643 missense probably benign 0.32
R7816:Zfp981 UTSW 4 146537643 missense probably benign 0.32
R8020:Zfp981 UTSW 4 146537368 missense possibly damaging 0.91
R8797:Zfp981 UTSW 4 146535449 nonsense probably null
R8805:Zfp981 UTSW 4 146537953 missense possibly damaging 0.86
R9324:Zfp981 UTSW 4 146535427 missense possibly damaging 0.95
R9471:Zfp981 UTSW 4 146537623 missense probably benign
Z1176:Zfp981 UTSW 4 146537090 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGTAGTGAATGCGACAAATGCTT -3'
(R):5'- CATTGACTGCATTTGTAAGGCTTCT -3'

Sequencing Primer
(F):5'- TGCGACAAATGCTTTACTGAC -3'
(R):5'- CTCTGATGCCTTCTCAGAGTGAG -3'
Posted On 2019-12-20