Incidental Mutation 'R7835:Vmn1r57'
ID605912
Institutional Source Beutler Lab
Gene Symbol Vmn1r57
Ensembl Gene ENSMUSG00000091652
Gene Namevomeronasal 1 receptor 57
SynonymsGm7519
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location5218493-5221736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5221139 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 221 (H221L)
Ref Sequence ENSEMBL: ENSMUSP00000131917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170780] [ENSMUST00000227798] [ENSMUST00000228062]
Predicted Effect probably benign
Transcript: ENSMUST00000170780
AA Change: H221L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131917
Gene: ENSMUSG00000091652
AA Change: H221L

DomainStartEndE-ValueType
Pfam:TAS2R 1 290 1.7e-12 PFAM
Pfam:7tm_1 20 279 1.8e-6 PFAM
Pfam:V1R 32 289 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227798
AA Change: H221L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228062
AA Change: H221L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Vmn1r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01770:Vmn1r57 APN 7 5220668 missense possibly damaging 0.61
IGL03124:Vmn1r57 APN 7 5221022 missense possibly damaging 0.91
R1779:Vmn1r57 UTSW 7 5220577 missense possibly damaging 0.89
R3025:Vmn1r57 UTSW 7 5220715 nonsense probably null
R3917:Vmn1r57 UTSW 7 5220631 missense probably damaging 1.00
R4093:Vmn1r57 UTSW 7 5220857 missense possibly damaging 0.80
R4552:Vmn1r57 UTSW 7 5220668 missense possibly damaging 0.61
R4628:Vmn1r57 UTSW 7 5220973 missense probably damaging 1.00
R5186:Vmn1r57 UTSW 7 5221108 missense probably benign 0.08
R5290:Vmn1r57 UTSW 7 5221320 missense probably damaging 1.00
R5559:Vmn1r57 UTSW 7 5220899 missense probably damaging 1.00
R6372:Vmn1r57 UTSW 7 5220827 missense possibly damaging 0.61
R7105:Vmn1r57 UTSW 7 5220500 missense probably damaging 1.00
R7220:Vmn1r57 UTSW 7 5220560 missense probably null 1.00
R7872:Vmn1r57 UTSW 7 5220614 missense possibly damaging 0.48
R8310:Vmn1r57 UTSW 7 5221025 missense probably damaging 1.00
X0064:Vmn1r57 UTSW 7 5220761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGTGGTCCACAGAAATCAC -3'
(R):5'- GCAGAGAACAATGACCCCTAGG -3'

Sequencing Primer
(F):5'- GTGGTCCACAGAAATCACACAATG -3'
(R):5'- GGTTCCCTAAATATCAACAGTAAGGG -3'
Posted On2019-12-20