Incidental Mutation 'R7835:Ccne1'
ID605915
Institutional Source Beutler Lab
Gene Symbol Ccne1
Ensembl Gene ENSMUSG00000002068
Gene Namecyclin E1
SynonymsCycE1, cyclin E
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7835 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location38097984-38107534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 38102845 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 133 (Q133K)
Ref Sequence ENSEMBL: ENSMUSP00000103658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108023] [ENSMUST00000124979] [ENSMUST00000130329]
Predicted Effect probably benign
Transcript: ENSMUST00000108023
AA Change: Q133K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103658
Gene: ENSMUSG00000002068
AA Change: Q133K

DomainStartEndE-ValueType
CYCLIN 148 233 5.88e-26 SMART
Cyclin_C 242 364 2.36e-13 SMART
low complexity region 385 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124979
Predicted Effect probably benign
Transcript: ENSMUST00000130329
AA Change: Q133K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117662
Gene: ENSMUSG00000002068
AA Change: Q133K

DomainStartEndE-ValueType
Pfam:Cyclin_N 113 167 5.4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Ccne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Ccne1 APN 7 38106301 missense probably benign 0.22
IGL02377:Ccne1 APN 7 38098990 critical splice donor site probably null
IGL02800:Ccne1 APN 7 38102799 missense probably damaging 1.00
R1355:Ccne1 UTSW 7 38106322 missense possibly damaging 0.80
R1938:Ccne1 UTSW 7 38106277 critical splice donor site probably null
R4810:Ccne1 UTSW 7 38099593 missense probably damaging 1.00
R4858:Ccne1 UTSW 7 38099319 missense probably damaging 1.00
R4982:Ccne1 UTSW 7 38100571 missense probably damaging 1.00
R6480:Ccne1 UTSW 7 38106854 start gained probably benign
R6981:Ccne1 UTSW 7 38098573 unclassified probably benign
R7165:Ccne1 UTSW 7 38099301 missense probably damaging 1.00
R7398:Ccne1 UTSW 7 38106277 critical splice donor site probably null
R7458:Ccne1 UTSW 7 38100671 missense probably damaging 1.00
R7918:Ccne1 UTSW 7 38102845 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCAACTTTAATATGTCTAAGGGAC -3'
(R):5'- CATTTCAGCCTCGGAAAATCAGAC -3'

Sequencing Primer
(F):5'- AGGGACAAGATTATTTCAGAAACTTC -3'
(R):5'- GACCCATGGCTTCTCAGTG -3'
Posted On2019-12-20