Incidental Mutation 'R7835:Olfm5'
ID605918
Institutional Source Beutler Lab
Gene Symbol Olfm5
Ensembl Gene ENSMUSG00000044265
Gene Nameolfactomedin 5
SynonymsE030002O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104153013-104164831 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 104154445 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 195 (Y195*)
Ref Sequence ENSEMBL: ENSMUSP00000117893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121] [ENSMUST00000154555]
Predicted Effect probably null
Transcript: ENSMUST00000051137
AA Change: Y270*
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265
AA Change: Y270*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059121
SMART Domains Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437

DomainStartEndE-ValueType
UBQ 31 101 5.13e-16 SMART
Blast:STI1 199 237 8e-11 BLAST
low complexity region 339 350 N/A INTRINSIC
low complexity region 402 419 N/A INTRINSIC
PDB:2DNA|A 561 610 3e-26 PDB
Blast:UBA 568 604 1e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000154555
AA Change: Y195*
SMART Domains Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265
AA Change: Y195*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 123 N/A INTRINSIC
OLF 136 304 3.65e-10 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Olfm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Olfm5 APN 7 104160744 missense possibly damaging 0.77
IGL02097:Olfm5 APN 7 104154231 missense probably benign 0.20
IGL02322:Olfm5 APN 7 104154401 missense probably damaging 1.00
IGL02324:Olfm5 APN 7 104154095 splice site probably null
IGL02702:Olfm5 APN 7 104154357 missense probably damaging 1.00
R0128:Olfm5 UTSW 7 104160926 missense probably benign
R0400:Olfm5 UTSW 7 104154179 missense probably damaging 1.00
R0600:Olfm5 UTSW 7 104153869 nonsense probably null
R0610:Olfm5 UTSW 7 104154445 nonsense probably null
R0699:Olfm5 UTSW 7 104154119 missense probably damaging 1.00
R1960:Olfm5 UTSW 7 104160412 missense possibly damaging 0.85
R1978:Olfm5 UTSW 7 104164741 missense unknown
R2391:Olfm5 UTSW 7 104160834 missense probably benign 0.00
R3774:Olfm5 UTSW 7 104161849 missense possibly damaging 0.67
R4632:Olfm5 UTSW 7 104160893 missense probably benign 0.00
R4770:Olfm5 UTSW 7 104160478 missense probably benign 0.04
R4838:Olfm5 UTSW 7 104154365 missense probably damaging 1.00
R5274:Olfm5 UTSW 7 104159983 missense probably damaging 1.00
R5455:Olfm5 UTSW 7 104154462 missense probably damaging 0.99
R5930:Olfm5 UTSW 7 104154155 missense probably damaging 1.00
R6416:Olfm5 UTSW 7 104154053 missense probably damaging 1.00
R7126:Olfm5 UTSW 7 104159980 missense probably damaging 1.00
R7535:Olfm5 UTSW 7 104154237 missense possibly damaging 0.92
R7682:Olfm5 UTSW 7 104161772 missense probably null 0.49
R8308:Olfm5 UTSW 7 104154399 missense probably damaging 1.00
R8531:Olfm5 UTSW 7 104153822 missense probably benign 0.00
X0011:Olfm5 UTSW 7 104153946 missense possibly damaging 0.91
Z1088:Olfm5 UTSW 7 104154150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTTGTAGGTGGCACCAG -3'
(R):5'- ATGCCATATGAGACTTCCCAC -3'

Sequencing Primer
(F):5'- CCAGGCAATGGGCGTCG -3'
(R):5'- ATGTACACATCTTTAGGGCTGACCG -3'
Posted On2019-12-20