Incidental Mutation 'R7835:Wee1'
ID605919
Institutional Source Beutler Lab
Gene Symbol Wee1
Ensembl Gene ENSMUSG00000031016
Gene NameWEE 1 homolog 1 (S. pombe)
SynonymsWee1A
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location110122046-110143286 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 110130878 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 396 (Y396*)
Ref Sequence ENSEMBL: ENSMUSP00000033326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033326]
Predicted Effect probably null
Transcript: ENSMUST00000033326
AA Change: Y396*
SMART Domains Protein: ENSMUSP00000033326
Gene: ENSMUSG00000031016
AA Change: Y396*

DomainStartEndE-ValueType
low complexity region 62 112 N/A INTRINSIC
Pfam:Pkinase_Tyr 298 566 1.9e-26 PFAM
Pfam:Pkinase 298 568 1.7e-61 PFAM
low complexity region 620 631 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is a tyrosine kinase belonging to the Ser/Thr family of protein kinases. This protein catalyzes the inhibitory tyrosine phosphorylation of CDC2/cyclin B kinase, and appears to coordinate the transition between DNA replication and mitosis by protecting the nucleus from cytoplasmically activated CDC2 kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. Mice homozygous for a knock-out allele exhibit lethality between E3.5 and E7.5 with reduced proliferation, increased apoptosis and abnormal G2/M checkpoint function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Wee1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Wee1 APN 7 110134853 splice site probably null
IGL00981:Wee1 APN 7 110139669 missense probably damaging 1.00
IGL01017:Wee1 APN 7 110125848 missense possibly damaging 0.93
IGL01357:Wee1 APN 7 110142035 missense probably benign 0.39
IGL01838:Wee1 APN 7 110124537 missense probably benign 0.01
IGL01970:Wee1 APN 7 110139250 missense probably damaging 1.00
IGL02396:Wee1 APN 7 110142093 missense probably damaging 1.00
IGL02511:Wee1 APN 7 110139276 missense possibly damaging 0.55
IGL02884:Wee1 APN 7 110126062 missense probably benign 0.02
IGL03085:Wee1 APN 7 110124598 missense probably damaging 1.00
IGL03221:Wee1 APN 7 110126817 missense probably damaging 1.00
IGL03383:Wee1 APN 7 110139692 missense probably damaging 1.00
R0220:Wee1 UTSW 7 110124526 missense probably benign 0.10
R1934:Wee1 UTSW 7 110122491 missense probably benign 0.06
R3110:Wee1 UTSW 7 110130836 missense probably damaging 1.00
R3112:Wee1 UTSW 7 110130836 missense probably damaging 1.00
R3978:Wee1 UTSW 7 110124555 missense probably damaging 1.00
R4348:Wee1 UTSW 7 110130958 missense probably damaging 1.00
R5434:Wee1 UTSW 7 110124569 frame shift probably null
R5435:Wee1 UTSW 7 110124569 frame shift probably null
R5436:Wee1 UTSW 7 110124569 frame shift probably null
R5449:Wee1 UTSW 7 110124569 frame shift probably null
R5566:Wee1 UTSW 7 110126050 nonsense probably null
R5630:Wee1 UTSW 7 110124569 frame shift probably null
R5632:Wee1 UTSW 7 110124569 frame shift probably null
R5685:Wee1 UTSW 7 110124569 frame shift probably null
R5694:Wee1 UTSW 7 110124569 frame shift probably null
R5807:Wee1 UTSW 7 110124569 frame shift probably null
R5941:Wee1 UTSW 7 110124569 frame shift probably null
R6044:Wee1 UTSW 7 110139306 missense probably benign 0.00
R6163:Wee1 UTSW 7 110135651 missense probably damaging 1.00
R6826:Wee1 UTSW 7 110124663 critical splice donor site probably null
R7203:Wee1 UTSW 7 110134794 missense probably benign 0.00
R8273:Wee1 UTSW 7 110124484 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGATATCCCAAGAAAGTTGAACC -3'
(R):5'- CCAGTGTCAGAGTGGTCTAATC -3'

Sequencing Primer
(F):5'- TATCCCAAGAAAGTTGAACCAAGAG -3'
(R):5'- GTCAGAGTGGTCTAATCATAAAACCC -3'
Posted On2019-12-20