Mutagenetix > Incidental Mutations

Incidental Mutation 'R7835:Wee1'

605919

Institutional Source

Beutler Lab

Gene Symbol

Wee1

Ensembl Gene

ENSMUSG00000031016

Gene Name

WEE 1 homolog 1 (S. pombe)

Synonyms

Wee1A

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7835 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110122046-110143286 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 110130878 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 396 (Y396*)

Ref Sequence

ENSEMBL: ENSMUSP00000033326 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033326]

Predicted Effect

probably null
Transcript: ENSMUST00000033326
AA Change: Y396*

SMART Domains

Protein: ENSMUSP00000033326
Gene: ENSMUSG00000031016
AA Change: Y396*

Domain	Start	End	E-Value	Type
low complexity region	62	112	N/A	INTRINSIC
Pfam:Pkinase_Tyr	298	566	1.9e-26	PFAM
Pfam:Pkinase	298	568	1.7e-61	PFAM
low complexity region	620	631	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is a tyrosine kinase belonging to the Ser/Thr family of protein kinases. This protein catalyzes the inhibitory tyrosine phosphorylation of CDC2/cyclin B kinase, and appears to coordinate the transition between DNA replication and mitosis by protecting the nucleus from cytoplasmically activated CDC2 kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. Mice homozygous for a knock-out allele exhibit lethality between E3.5 and E7.5 with reduced proliferation, increased apoptosis and abnormal G2/M checkpoint function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	A	7: 79,099,875	S1465T	probably benign	Het
Accsl	T	A	2: 93,865,984	K90*	probably null	Het
Adamts3	A	T	5: 89,700,440	D674E	possibly damaging	Het
Adap2	T	A	11: 80,160,231	V129D	probably benign	Het
Ank3	A	G	10: 69,987,727	D742G		Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C330021F23Rik	A	G	8: 3,580,452		probably benign	Het
Cachd1	G	T	4: 100,974,153		probably null	Het
Ccne1	G	T	7: 38,102,845	Q133K	probably benign	Het
Cers3	C	T	7: 66,773,639	H111Y	possibly damaging	Het
Chst5	A	T	8: 111,890,602	L129M	probably damaging	Het
Depdc7	A	G	2: 104,728,185	S164P	probably benign	Het
Dnah10	G	A	5: 124,777,234	A1966T	probably damaging	Het
Fam208a	G	T	14: 27,476,643	G1311C	probably damaging	Het
Fcgbp	T	G	7: 28,117,207	S2365A	possibly damaging	Het
Ihh	A	G	1: 74,946,366	V320A	probably damaging	Het
Kdm5d	T	C	Y: 900,558	V201A	possibly damaging	Het
Kif13b	T	A	14: 64,767,452	H1117Q	probably benign	Het
Lcn8	C	A	2: 25,655,296		probably null	Het
Lrp4	T	C	2: 91,495,042	V1404A	possibly damaging	Het
Lrrc61	A	T	6: 48,568,572	T110S	probably benign	Het
Mrpl19	G	A	6: 81,962,126	R232C	probably damaging	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Mzt1	T	C	14: 99,046,003	T21A	probably benign	Het
Naip6	G	T	13: 100,316,004	A183E	probably benign	Het
Neb	T	C	2: 52,150,577	D6624G	probably benign	Het
Nup85	A	G	11: 115,570,071	D183G	probably benign	Het
Olfm5	A	T	7: 104,154,445	Y195*	probably null	Het
Olfr828	T	A	9: 18,815,809	M162L	probably benign	Het
Piezo2	A	T	18: 63,082,945	F1216I	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Polr1a	T	C	6: 71,915,142	V135A	probably benign	Het
Ppcdc	A	G	9: 57,420,276	S83P	probably benign	Het
Prss21	A	T	17: 23,869,451	Q130L	possibly damaging	Het
Rdx	T	A	9: 52,065,788	N112K	probably damaging	Het
Rgs22	A	G	15: 36,081,911		probably null	Het
Rps26	C	T	10: 128,626,126	V40I	probably benign	Het
Runx2	A	T	17: 44,608,236	M405K	probably damaging	Het
Serinc2	A	C	4: 130,275,487	C4G	unknown	Het
Sh3rf2	C	A	18: 42,111,170	R266S	probably benign	Het
Slc38a10	A	G	11: 120,116,996	I386T	possibly damaging	Het
Stab2	G	A	10: 86,872,619	P1694L	probably benign	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tmem102	A	G	11: 69,804,345	V267A	probably damaging	Het
Trim65	A	G	11: 116,130,929	L26P	probably damaging	Het
Vmn1r160	T	A	7: 22,871,954	M244K	possibly damaging	Het
Vmn1r57	A	T	7: 5,221,139	H221L	probably benign	Het
Wdr89	C	A	12: 75,632,899	V194F	probably damaging	Het
Zfp451	A	T	1: 33,772,979	V885D	probably damaging	Het
Zfp981	A	T	4: 146,537,876	Q419H	probably benign	Het
Znfx1	A	G	2: 167,039,827	Y1081H	probably damaging	Het

Other mutations in Wee1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Wee1	APN	7	110134853	splice site	probably null
IGL00981:Wee1	APN	7	110139669	missense	probably damaging	1.00
IGL01017:Wee1	APN	7	110125848	missense	possibly damaging	0.93
IGL01357:Wee1	APN	7	110142035	missense	probably benign	0.39
IGL01838:Wee1	APN	7	110124537	missense	probably benign	0.01
IGL01970:Wee1	APN	7	110139250	missense	probably damaging	1.00
IGL02396:Wee1	APN	7	110142093	missense	probably damaging	1.00
IGL02511:Wee1	APN	7	110139276	missense	possibly damaging	0.55
IGL02884:Wee1	APN	7	110126062	missense	probably benign	0.02
IGL03085:Wee1	APN	7	110124598	missense	probably damaging	1.00
IGL03221:Wee1	APN	7	110126817	missense	probably damaging	1.00
IGL03383:Wee1	APN	7	110139692	missense	probably damaging	1.00
R0220:Wee1	UTSW	7	110124526	missense	probably benign	0.10
R1934:Wee1	UTSW	7	110122491	missense	probably benign	0.06
R3110:Wee1	UTSW	7	110130836	missense	probably damaging	1.00
R3112:Wee1	UTSW	7	110130836	missense	probably damaging	1.00
R3978:Wee1	UTSW	7	110124555	missense	probably damaging	1.00
R4348:Wee1	UTSW	7	110130958	missense	probably damaging	1.00
R5434:Wee1	UTSW	7	110124569	frame shift	probably null
R5435:Wee1	UTSW	7	110124569	frame shift	probably null
R5436:Wee1	UTSW	7	110124569	frame shift	probably null
R5449:Wee1	UTSW	7	110124569	frame shift	probably null
R5566:Wee1	UTSW	7	110126050	nonsense	probably null
R5630:Wee1	UTSW	7	110124569	frame shift	probably null
R5632:Wee1	UTSW	7	110124569	frame shift	probably null
R5685:Wee1	UTSW	7	110124569	frame shift	probably null
R5694:Wee1	UTSW	7	110124569	frame shift	probably null
R5807:Wee1	UTSW	7	110124569	frame shift	probably null
R5941:Wee1	UTSW	7	110124569	frame shift	probably null
R6044:Wee1	UTSW	7	110139306	missense	probably benign	0.00
R6163:Wee1	UTSW	7	110135651	missense	probably damaging	1.00
R6826:Wee1	UTSW	7	110124663	critical splice donor site	probably null
R7203:Wee1	UTSW	7	110134794	missense	probably benign	0.00
R8273:Wee1	UTSW	7	110124484	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTTGATATCCCAAGAAAGTTGAACC -3'
(R):5'- CCAGTGTCAGAGTGGTCTAATC -3'

Sequencing Primer
(F):5'- TATCCCAAGAAAGTTGAACCAAGAG -3'
(R):5'- GTCAGAGTGGTCTAATCATAAAACCC -3'

Posted On

2019-12-20