Incidental Mutation 'R7835:C330021F23Rik'
ID 605921
Institutional Source Beutler Lab
Gene Symbol C330021F23Rik
Ensembl Gene ENSMUSG00000065952
Gene Name RIKEN cDNA C330021F23 gene
Synonyms Rps23rg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R7835 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 3567990-3584939 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 3580452 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086479] [ENSMUST00000136592] [ENSMUST00000151633]
AlphaFold Q8C7T0
Predicted Effect probably benign
Transcript: ENSMUST00000086479
SMART Domains Protein: ENSMUSP00000136628
Gene: ENSMUSG00000065952

DomainStartEndE-ValueType
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136592
SMART Domains Protein: ENSMUSP00000123235
Gene: ENSMUSG00000065952

DomainStartEndE-ValueType
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151633
SMART Domains Protein: ENSMUSP00000119487
Gene: ENSMUSG00000065952

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in C330021F23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:C330021F23Rik APN 8 3583904 missense probably benign 0.02
R1291:C330021F23Rik UTSW 8 3583938 missense probably damaging 1.00
R4755:C330021F23Rik UTSW 8 3583922 missense probably damaging 1.00
R7796:C330021F23Rik UTSW 8 3584160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGACCCGTGCCTAAGTAC -3'
(R):5'- AGAACCCCTCTCTGTTGTTGTG -3'

Sequencing Primer
(F):5'- AGACCCGTGCCTAAGTACATGTG -3'
(R):5'- GCCCAGCTGAAATGGTAAACTTTC -3'
Posted On 2019-12-20