Mutagenetix > Incidental Mutations

Incidental Mutation 'R7835:Olfr828'

605924

Institutional Source

Beutler Lab

Gene Symbol

Olfr828

Ensembl Gene

ENSMUSG00000078116

Gene Name

olfactory receptor 828

Synonyms

MOR149-1, GA_x6K02T2PVTD-12559294-12558356

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R7835 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18814728-18819526 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18815809 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 162 (M162L)

Ref Sequence

ENSEMBL: ENSMUSP00000148853 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000104914] [ENSMUST00000215380]

Predicted Effect

probably benign
Transcript: ENSMUST00000104914
AA Change: M162L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000100514
Gene: ENSMUSG00000078116
AA Change: M162L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	310	1e-48	PFAM
Pfam:7TM_GPCR_Srsx	35	305	1.4e-5	PFAM
Pfam:7tm_1	41	290	2.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215380
AA Change: M162L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	A	7: 79,099,875	S1465T	probably benign	Het
Accsl	T	A	2: 93,865,984	K90*	probably null	Het
Adamts3	A	T	5: 89,700,440	D674E	possibly damaging	Het
Adap2	T	A	11: 80,160,231	V129D	probably benign	Het
Ank3	A	G	10: 69,987,727	D742G		Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C330021F23Rik	A	G	8: 3,580,452		probably benign	Het
Cachd1	G	T	4: 100,974,153		probably null	Het
Ccne1	G	T	7: 38,102,845	Q133K	probably benign	Het
Cers3	C	T	7: 66,773,639	H111Y	possibly damaging	Het
Chst5	A	T	8: 111,890,602	L129M	probably damaging	Het
Depdc7	A	G	2: 104,728,185	S164P	probably benign	Het
Dnah10	G	A	5: 124,777,234	A1966T	probably damaging	Het
Fam208a	G	T	14: 27,476,643	G1311C	probably damaging	Het
Fcgbp	T	G	7: 28,117,207	S2365A	possibly damaging	Het
Ihh	A	G	1: 74,946,366	V320A	probably damaging	Het
Kdm5d	T	C	Y: 900,558	V201A	possibly damaging	Het
Kif13b	T	A	14: 64,767,452	H1117Q	probably benign	Het
Lcn8	C	A	2: 25,655,296		probably null	Het
Lrp4	T	C	2: 91,495,042	V1404A	possibly damaging	Het
Lrrc61	A	T	6: 48,568,572	T110S	probably benign	Het
Mrpl19	G	A	6: 81,962,126	R232C	probably damaging	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Mzt1	T	C	14: 99,046,003	T21A	probably benign	Het
Naip6	G	T	13: 100,316,004	A183E	probably benign	Het
Neb	T	C	2: 52,150,577	D6624G	probably benign	Het
Nup85	A	G	11: 115,570,071	D183G	probably benign	Het
Olfm5	A	T	7: 104,154,445	Y195*	probably null	Het
Piezo2	A	T	18: 63,082,945	F1216I	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Polr1a	T	C	6: 71,915,142	V135A	probably benign	Het
Ppcdc	A	G	9: 57,420,276	S83P	probably benign	Het
Prss21	A	T	17: 23,869,451	Q130L	possibly damaging	Het
Rdx	T	A	9: 52,065,788	N112K	probably damaging	Het
Rgs22	A	G	15: 36,081,911		probably null	Het
Rps26	C	T	10: 128,626,126	V40I	probably benign	Het
Runx2	A	T	17: 44,608,236	M405K	probably damaging	Het
Serinc2	A	C	4: 130,275,487	C4G	unknown	Het
Sh3rf2	C	A	18: 42,111,170	R266S	probably benign	Het
Slc38a10	A	G	11: 120,116,996	I386T	possibly damaging	Het
Stab2	G	A	10: 86,872,619	P1694L	probably benign	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tmem102	A	G	11: 69,804,345	V267A	probably damaging	Het
Trim65	A	G	11: 116,130,929	L26P	probably damaging	Het
Vmn1r160	T	A	7: 22,871,954	M244K	possibly damaging	Het
Vmn1r57	A	T	7: 5,221,139	H221L	probably benign	Het
Wdr89	C	A	12: 75,632,899	V194F	probably damaging	Het
Wee1	C	A	7: 110,130,878	Y396*	probably null	Het
Zfp451	A	T	1: 33,772,979	V885D	probably damaging	Het
Zfp981	A	T	4: 146,537,876	Q419H	probably benign	Het
Znfx1	A	G	2: 167,039,827	Y1081H	probably damaging	Het

Other mutations in Olfr828

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02088:Olfr828	APN	9	18815923	missense	probably benign	0.03
IGL02103:Olfr828	APN	9	18815709	missense	probably damaging	1.00
IGL02792:Olfr828	APN	9	18815958	missense	probably benign	0.00
IGL02964:Olfr828	APN	9	18815728	missense	probably damaging	1.00
IGL03087:Olfr828	APN	9	18816084	missense	probably damaging	1.00
IGL03105:Olfr828	APN	9	18815389	missense	probably benign	0.03
R0330:Olfr828	UTSW	9	18815641	missense	probably damaging	1.00
R0335:Olfr828	UTSW	9	18815994	missense	probably damaging	1.00
R0862:Olfr828	UTSW	9	18815706	missense	probably damaging	0.98
R1226:Olfr828	UTSW	9	18815970	missense	probably benign	0.34
R2004:Olfr828	UTSW	9	18815505	missense	probably benign	0.05
R2005:Olfr828	UTSW	9	18815505	missense	probably benign	0.05
R2006:Olfr828	UTSW	9	18815505	missense	probably benign	0.05
R2199:Olfr828	UTSW	9	18815923	missense	probably damaging	0.97
R2230:Olfr828	UTSW	9	18815725	missense	probably damaging	1.00
R2399:Olfr828	UTSW	9	18816027	missense	probably benign	0.07
R5652:Olfr828	UTSW	9	18815626	missense	probably damaging	1.00
R5738:Olfr828	UTSW	9	18815829	missense	possibly damaging	0.81
R6416:Olfr828	UTSW	9	18815892	missense	probably benign	0.21
R6813:Olfr828	UTSW	9	18815892	missense	probably benign	0.21
R7092:Olfr828	UTSW	9	18816057	missense	probably damaging	1.00
R7109:Olfr828	UTSW	9	18815608	missense	probably benign	0.01
R7292:Olfr828	UTSW	9	18816190	missense	probably damaging	1.00
R7429:Olfr828	UTSW	9	18815354	makesense	probably null
R7430:Olfr828	UTSW	9	18815354	makesense	probably null
R7490:Olfr828	UTSW	9	18815933	nonsense	probably null
R8016:Olfr828	UTSW	9	18816292	start codon destroyed	probably null	0.56
R8809:Olfr828	UTSW	9	18815623	missense	probably damaging	0.99
RF003:Olfr828	UTSW	9	18815482	missense	probably benign	0.03
X0026:Olfr828	UTSW	9	18815763	missense	possibly damaging	0.95
Z1176:Olfr828	UTSW	9	18815980	frame shift	probably null
Z1177:Olfr828	UTSW	9	18816148	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AGACATTCTCAAAACAGATGAGGC -3'
(R):5'- CTAGCTGTCTTACACAAATCTGC -3'

Sequencing Primer
(F):5'- TCTCAAAACAGATGAGGCAATTTGAG -3'
(R):5'- AGCTGTCTTACACAAATCTGCTTTAC -3'

Posted On

2019-12-20