Incidental Mutation 'R7835:Olfr828'
ID605924
Institutional Source Beutler Lab
Gene Symbol Olfr828
Ensembl Gene ENSMUSG00000078116
Gene Nameolfactory receptor 828
SynonymsMOR149-1, GA_x6K02T2PVTD-12559294-12558356
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18814728-18819526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18815809 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 162 (M162L)
Ref Sequence ENSEMBL: ENSMUSP00000148853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104914] [ENSMUST00000215380]
Predicted Effect probably benign
Transcript: ENSMUST00000104914
AA Change: M162L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100514
Gene: ENSMUSG00000078116
AA Change: M162L

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215380
AA Change: M162L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Olfr828
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Olfr828 APN 9 18815923 missense probably benign 0.03
IGL02103:Olfr828 APN 9 18815709 missense probably damaging 1.00
IGL02792:Olfr828 APN 9 18815958 missense probably benign 0.00
IGL02964:Olfr828 APN 9 18815728 missense probably damaging 1.00
IGL03087:Olfr828 APN 9 18816084 missense probably damaging 1.00
IGL03105:Olfr828 APN 9 18815389 missense probably benign 0.03
R0330:Olfr828 UTSW 9 18815641 missense probably damaging 1.00
R0335:Olfr828 UTSW 9 18815994 missense probably damaging 1.00
R0862:Olfr828 UTSW 9 18815706 missense probably damaging 0.98
R1226:Olfr828 UTSW 9 18815970 missense probably benign 0.34
R2004:Olfr828 UTSW 9 18815505 missense probably benign 0.05
R2005:Olfr828 UTSW 9 18815505 missense probably benign 0.05
R2006:Olfr828 UTSW 9 18815505 missense probably benign 0.05
R2199:Olfr828 UTSW 9 18815923 missense probably damaging 0.97
R2230:Olfr828 UTSW 9 18815725 missense probably damaging 1.00
R2399:Olfr828 UTSW 9 18816027 missense probably benign 0.07
R5652:Olfr828 UTSW 9 18815626 missense probably damaging 1.00
R5738:Olfr828 UTSW 9 18815829 missense possibly damaging 0.81
R6416:Olfr828 UTSW 9 18815892 missense probably benign 0.21
R6813:Olfr828 UTSW 9 18815892 missense probably benign 0.21
R7092:Olfr828 UTSW 9 18816057 missense probably damaging 1.00
R7109:Olfr828 UTSW 9 18815608 missense probably benign 0.01
R7292:Olfr828 UTSW 9 18816190 missense probably damaging 1.00
R7429:Olfr828 UTSW 9 18815354 makesense probably null
R7430:Olfr828 UTSW 9 18815354 makesense probably null
R7490:Olfr828 UTSW 9 18815933 nonsense probably null
R8016:Olfr828 UTSW 9 18816292 start codon destroyed probably null 0.56
R8809:Olfr828 UTSW 9 18815623 missense probably damaging 0.99
RF003:Olfr828 UTSW 9 18815482 missense probably benign 0.03
X0026:Olfr828 UTSW 9 18815763 missense possibly damaging 0.95
Z1176:Olfr828 UTSW 9 18815980 frame shift probably null
Z1177:Olfr828 UTSW 9 18816148 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGACATTCTCAAAACAGATGAGGC -3'
(R):5'- CTAGCTGTCTTACACAAATCTGC -3'

Sequencing Primer
(F):5'- TCTCAAAACAGATGAGGCAATTTGAG -3'
(R):5'- AGCTGTCTTACACAAATCTGCTTTAC -3'
Posted On2019-12-20