Incidental Mutation 'R7835:Rdx'
ID 605925
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
MMRRC Submission 045889-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7835 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 51958450-52000038 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 51977088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 112 (N112K)
Ref Sequence ENSEMBL: ENSMUSP00000000590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
AlphaFold P26043
Predicted Effect probably damaging
Transcript: ENSMUST00000000590
AA Change: N112K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: N112K

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000061352
AA Change: N112K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: N112K

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163153
AA Change: N112K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: N112K

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Meta Mutation Damage Score 0.1366 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 78,749,623 (GRCm39) S1465T probably benign Het
Accsl T A 2: 93,696,329 (GRCm39) K90* probably null Het
Adamts3 A T 5: 89,848,299 (GRCm39) D674E possibly damaging Het
Adap2 T A 11: 80,051,057 (GRCm39) V129D probably benign Het
Ank3 A G 10: 69,823,557 (GRCm39) D742G Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cachd1 G T 4: 100,831,350 (GRCm39) probably null Het
Ccne1 G T 7: 37,802,270 (GRCm39) Q133K probably benign Het
Cers3 C T 7: 66,423,387 (GRCm39) H111Y possibly damaging Het
Chst5 A T 8: 112,617,234 (GRCm39) L129M probably damaging Het
Depdc7 A G 2: 104,558,530 (GRCm39) S164P probably benign Het
Dnah10 G A 5: 124,854,298 (GRCm39) A1966T probably damaging Het
Fcgbp T G 7: 27,816,632 (GRCm39) S2365A possibly damaging Het
Ihh A G 1: 74,985,525 (GRCm39) V320A probably damaging Het
Kdm5d T C Y: 900,558 (GRCm39) V201A possibly damaging Het
Kif13b T A 14: 65,004,901 (GRCm39) H1117Q probably benign Het
Lcn8 C A 2: 25,545,308 (GRCm39) probably null Het
Lrp4 T C 2: 91,325,387 (GRCm39) V1404A possibly damaging Het
Lrrc61 A T 6: 48,545,506 (GRCm39) T110S probably benign Het
Mrpl19 G A 6: 81,939,107 (GRCm39) R232C probably damaging Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Mzt1 T C 14: 99,283,439 (GRCm39) T21A probably benign Het
Naip6 G T 13: 100,452,512 (GRCm39) A183E probably benign Het
Neb T C 2: 52,040,589 (GRCm39) D6624G probably benign Het
Nup85 A G 11: 115,460,897 (GRCm39) D183G probably benign Het
Olfm5 A T 7: 103,803,652 (GRCm39) Y195* probably null Het
Or7g16 T A 9: 18,727,105 (GRCm39) M162L probably benign Het
Piezo2 A T 18: 63,216,016 (GRCm39) F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Polr1a T C 6: 71,892,126 (GRCm39) V135A probably benign Het
Ppcdc A G 9: 57,327,559 (GRCm39) S83P probably benign Het
Prss21 A T 17: 24,088,425 (GRCm39) Q130L possibly damaging Het
Rgs22 A G 15: 36,082,057 (GRCm39) probably null Het
Rps23rg1 A G 8: 3,630,452 (GRCm39) probably benign Het
Rps26 C T 10: 128,461,995 (GRCm39) V40I probably benign Het
Runx2 A T 17: 44,919,123 (GRCm39) M405K probably damaging Het
Serinc2 A C 4: 130,169,280 (GRCm39) C4G unknown Het
Sh3rf2 C A 18: 42,244,235 (GRCm39) R266S probably benign Het
Slc38a10 A G 11: 120,007,822 (GRCm39) I386T possibly damaging Het
Stab2 G A 10: 86,708,483 (GRCm39) P1694L probably benign Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tasor G T 14: 27,198,600 (GRCm39) G1311C probably damaging Het
Tmem102 A G 11: 69,695,171 (GRCm39) V267A probably damaging Het
Trim65 A G 11: 116,021,755 (GRCm39) L26P probably damaging Het
Vmn1r160 T A 7: 22,571,379 (GRCm39) M244K possibly damaging Het
Vmn1r57 A T 7: 5,224,138 (GRCm39) H221L probably benign Het
Wdr89 C A 12: 75,679,673 (GRCm39) V194F probably damaging Het
Wee1 C A 7: 109,730,085 (GRCm39) Y396* probably null Het
Zfp451 A T 1: 33,812,060 (GRCm39) V885D probably damaging Het
Zfp981 A T 4: 146,622,333 (GRCm39) Q419H probably benign Het
Znfx1 A G 2: 166,881,747 (GRCm39) Y1081H probably damaging Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 51,997,646 (GRCm39) missense probably damaging 1.00
IGL02088:Rdx APN 9 51,972,183 (GRCm39) utr 5 prime probably benign
IGL02522:Rdx APN 9 51,979,504 (GRCm39) missense possibly damaging 0.92
R0731:Rdx UTSW 9 51,979,518 (GRCm39) missense probably benign 0.05
R0748:Rdx UTSW 9 51,976,160 (GRCm39) missense possibly damaging 0.87
R0831:Rdx UTSW 9 51,977,117 (GRCm39) missense probably damaging 1.00
R1605:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R1688:Rdx UTSW 9 51,972,211 (GRCm39) splice site probably benign
R2127:Rdx UTSW 9 51,981,032 (GRCm39) missense possibly damaging 0.49
R2363:Rdx UTSW 9 51,980,173 (GRCm39) missense probably damaging 1.00
R2899:Rdx UTSW 9 51,980,211 (GRCm39) splice site probably benign
R4184:Rdx UTSW 9 51,978,680 (GRCm39) missense probably damaging 1.00
R4569:Rdx UTSW 9 51,980,141 (GRCm39) missense probably benign 0.07
R4607:Rdx UTSW 9 51,980,137 (GRCm39) missense probably damaging 0.99
R4760:Rdx UTSW 9 51,977,174 (GRCm39) missense probably benign 0.02
R4820:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R4966:Rdx UTSW 9 51,986,309 (GRCm39) missense probably benign 0.00
R6707:Rdx UTSW 9 51,974,954 (GRCm39) missense probably damaging 1.00
R7136:Rdx UTSW 9 51,997,745 (GRCm39) missense probably damaging 1.00
R7308:Rdx UTSW 9 51,980,170 (GRCm39) missense probably damaging 0.98
R7597:Rdx UTSW 9 51,972,196 (GRCm39) missense possibly damaging 0.84
R7923:Rdx UTSW 9 51,977,201 (GRCm39) missense possibly damaging 0.93
R8055:Rdx UTSW 9 51,997,724 (GRCm39) missense probably damaging 1.00
R8057:Rdx UTSW 9 51,976,946 (GRCm39) missense probably damaging 1.00
R8889:Rdx UTSW 9 51,997,753 (GRCm39) missense probably damaging 1.00
R8983:Rdx UTSW 9 51,974,905 (GRCm39) missense probably damaging 1.00
R9128:Rdx UTSW 9 51,976,179 (GRCm39) nonsense probably null
R9226:Rdx UTSW 9 51,992,468 (GRCm39) missense probably benign 0.01
R9377:Rdx UTSW 9 51,980,168 (GRCm39) missense possibly damaging 0.83
R9469:Rdx UTSW 9 51,977,069 (GRCm39) missense probably damaging 1.00
R9534:Rdx UTSW 9 51,984,482 (GRCm39) nonsense probably null
R9746:Rdx UTSW 9 51,974,878 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACCTGTGTTTGTCTATAAACTTACC -3'
(R):5'- AAGTCATGATCCACCTTGCAAC -3'

Sequencing Primer
(F):5'- CTTACCACCTTACATAGTATTACTGC -3'
(R):5'- CCACCTTGCAACTTAAAAATCTGTTG -3'
Posted On 2019-12-20