Incidental Mutation 'R0088:Tnfrsf21'
ID60593
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 038375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0088 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43038213 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 239 (H239Y)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 82% (32/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,914,067 K243R probably damaging Het
Akap9 C A 5: 3,961,946 T883K probably benign Het
Arhgap5 G T 12: 52,516,548 D101Y probably damaging Het
Bnc1 T G 7: 81,978,498 N39T possibly damaging Het
Carnmt1 T A 19: 18,677,853 H123Q probably benign Het
Cdh24 T C 14: 54,633,714 D92G probably damaging Het
Eomes A G 9: 118,478,673 E5G probably damaging Het
Eqtn T C 4: 94,919,990 T192A probably damaging Het
Fam110c T C 12: 31,075,218 V393A probably damaging Het
Fbll1 C A 11: 35,798,140 A99S possibly damaging Het
Il1rl2 A T 1: 40,365,053 I445F possibly damaging Het
Ipo8 T C 6: 148,801,936 T400A probably benign Het
Iqsec3 T C 6: 121,473,289 E92G probably damaging Het
Itpr2 C T 6: 146,241,185 V1679M probably benign Het
Kif2a G A 13: 106,975,432 A478V probably damaging Het
Lingo4 A G 3: 94,402,033 S93G probably benign Het
Mrpl37 A G 4: 107,064,424 S203P possibly damaging Het
Ndel1 A C 11: 68,833,420 S242R probably damaging Het
Nfatc3 T A 8: 106,127,942 M1036K possibly damaging Het
Ngrn T C 7: 80,264,455 I118T probably damaging Het
Olfr975 A G 9: 39,950,375 V132A probably benign Het
Pex10 A T 4: 155,070,498 S236C probably damaging Het
Phkb T G 8: 85,942,391 probably null Het
Pklr A G 3: 89,141,908 Y187C probably damaging Het
Plekhh1 A C 12: 79,055,366 E403D probably benign Het
Pls1 T C 9: 95,795,768 K22E possibly damaging Het
Prdm2 G A 4: 143,134,954 H589Y possibly damaging Het
Rabggtb C A 3: 153,908,830 R230L probably damaging Het
Rsph4a A G 10: 33,909,353 E420G probably benign Het
Sdk2 T C 11: 113,827,086 N1484S possibly damaging Het
St8sia3 T A 18: 64,266,985 V17E possibly damaging Het
Sult6b2 T A 6: 142,797,949 N117I probably damaging Het
Thbs2 T C 17: 14,681,701 T422A possibly damaging Het
Tmem266 A G 9: 55,437,329 D415G probably damaging Het
Ttyh2 G T 11: 114,690,255 G107C probably damaging Het
Ubr4 A G 4: 139,440,814 D2835G probably damaging Het
Zranb3 T C 1: 127,976,462 D540G probably benign Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
palmer_park UTSW 17 43038010 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAAAGCTCACACGGACTGTCTGG -3'
(R):5'- GCTCCATCTACACACGATTAGCTCC -3'

Sequencing Primer
(F):5'- GGACTGTCTGGGTCAGAAC -3'
(R):5'- acaactaaaatcactcaactcactc -3'
Posted On2013-07-24