Incidental Mutation 'R7835:Slc38a10'
ID605934
Institutional Source Beutler Lab
Gene Symbol Slc38a10
Ensembl Gene ENSMUSG00000061306
Gene Namesolute carrier family 38, member 10
Synonyms1810073N04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120103960-120151346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120116996 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 386 (I386T)
Ref Sequence ENSEMBL: ENSMUSP00000099307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045402] [ENSMUST00000076697] [ENSMUST00000103018] [ENSMUST00000179094]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045402
AA Change: I386T

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048675
Gene: ENSMUSG00000061306
AA Change: I386T

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1.5e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 699 735 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 1011 1019 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076697
SMART Domains Protein: ENSMUSP00000075989
Gene: ENSMUSG00000061306

DomainStartEndE-ValueType
Pfam:Aa_trans 4 389 4.7e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103018
AA Change: I386T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099307
Gene: ENSMUSG00000061306
AA Change: I386T

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 8.5e-55 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179094
AA Change: I386T

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136719
Gene: ENSMUSG00000061306
AA Change: I386T

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit a fragile skeleton, reduced adiposity, lean body mass, body weight/length, long bone length and bone mineral density, increased creatinine levels, reduced amylase and serum albumin levels, increased energy efficiency and oxygen consumption, and altered liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Slc38a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Slc38a10 APN 11 120138988 missense probably damaging 1.00
IGL00236:Slc38a10 APN 11 120106602 missense probably damaging 0.96
IGL01420:Slc38a10 APN 11 120106460 missense probably damaging 0.99
IGL01704:Slc38a10 APN 11 120151087 utr 5 prime probably benign
IGL01747:Slc38a10 APN 11 120134774 splice site probably benign
IGL02295:Slc38a10 APN 11 120116858 splice site probably benign
IGL02300:Slc38a10 APN 11 120110290 missense probably benign 0.00
IGL02429:Slc38a10 APN 11 120134888 splice site probably benign
IGL03155:Slc38a10 APN 11 120105119 missense probably damaging 0.96
IGL03396:Slc38a10 APN 11 120128475 missense probably damaging 1.00
Cascade UTSW 11 120147819 missense probably damaging 1.00
cherries UTSW 11 120151077 start codon destroyed probably null 1.00
Ore UTSW 11 120134853 missense probably damaging 1.00
rainier UTSW 11 120129312 nonsense probably null
slag UTSW 11 120132741 missense probably damaging 1.00
R0048:Slc38a10 UTSW 11 120110312 missense probably benign 0.11
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0069:Slc38a10 UTSW 11 120106502 missense probably damaging 1.00
R0101:Slc38a10 UTSW 11 120151077 start codon destroyed probably null 1.00
R0743:Slc38a10 UTSW 11 120140643 missense probably damaging 1.00
R1159:Slc38a10 UTSW 11 120105475 missense probably benign
R2101:Slc38a10 UTSW 11 120132741 missense probably damaging 1.00
R2367:Slc38a10 UTSW 11 120110261 missense probably benign 0.12
R4280:Slc38a10 UTSW 11 120137878 missense probably damaging 1.00
R4282:Slc38a10 UTSW 11 120129264 missense probably damaging 1.00
R5206:Slc38a10 UTSW 11 120105062 missense probably damaging 0.99
R5658:Slc38a10 UTSW 11 120105392 missense probably benign 0.11
R6114:Slc38a10 UTSW 11 120129312 nonsense probably null
R6118:Slc38a10 UTSW 11 120132843 missense probably damaging 1.00
R6306:Slc38a10 UTSW 11 120147819 missense probably damaging 1.00
R6395:Slc38a10 UTSW 11 120124382 missense probably benign 0.01
R6428:Slc38a10 UTSW 11 120105472 missense probably benign 0.09
R7764:Slc38a10 UTSW 11 120105079 missense probably damaging 1.00
R8790:Slc38a10 UTSW 11 120132693 missense possibly damaging 0.95
X0062:Slc38a10 UTSW 11 120116900 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ACCAGAGTTCAGGGATTTGGG -3'
(R):5'- CCACAGTGGTTAAGAAACTTGACC -3'

Sequencing Primer
(F):5'- GTCGGGGCCTGTGTATGTACC -3'
(R):5'- GAAACTTGACCTTAGCCTGGC -3'
Posted On2019-12-20