Incidental Mutation 'R7835:Wdr89'
ID 605935
Institutional Source Beutler Lab
Gene Symbol Wdr89
Ensembl Gene ENSMUSG00000045690
Gene Name WD repeat domain 89
Synonyms 2600001A11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7835 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 75630596-75669537 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 75632899 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 194 (V194F)
Ref Sequence ENSEMBL: ENSMUSP00000050532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062370] [ENSMUST00000187307]
AlphaFold Q9D0R9
Predicted Effect probably damaging
Transcript: ENSMUST00000062370
AA Change: V194F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050532
Gene: ENSMUSG00000045690
AA Change: V194F

DomainStartEndE-ValueType
WD40 20 56 3.82e1 SMART
WD40 59 98 1.85e-3 SMART
WD40 103 147 2.64e2 SMART
WD40 157 198 6.38e-7 SMART
WD40 205 244 1.1e2 SMART
WD40 308 348 1.82e-2 SMART
low complexity region 366 379 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187307
AA Change: V194F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140172
Gene: ENSMUSG00000045690
AA Change: V194F

DomainStartEndE-ValueType
WD40 20 56 3.82e1 SMART
WD40 59 98 1.85e-3 SMART
WD40 103 147 2.64e2 SMART
WD40 157 198 6.38e-7 SMART
WD40 205 244 1.1e2 SMART
WD40 308 348 1.82e-2 SMART
low complexity region 366 379 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Wdr89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Wdr89 APN 12 75633051 nonsense probably null
IGL02176:Wdr89 APN 12 75633123 missense probably damaging 0.96
IGL02472:Wdr89 APN 12 75632969 missense probably damaging 1.00
IGL02973:Wdr89 APN 12 75633099 missense probably damaging 0.98
R0003:Wdr89 UTSW 12 75632593 missense probably benign 0.00
R2060:Wdr89 UTSW 12 75632988 missense probably damaging 1.00
R4494:Wdr89 UTSW 12 75632747 missense probably damaging 1.00
R5120:Wdr89 UTSW 12 75632638 missense probably damaging 1.00
R5195:Wdr89 UTSW 12 75633288 missense probably benign 0.23
R6572:Wdr89 UTSW 12 75633385 missense probably damaging 1.00
R7487:Wdr89 UTSW 12 75632614 missense probably benign
R8445:Wdr89 UTSW 12 75632862 missense probably damaging 0.99
R8765:Wdr89 UTSW 12 75632914 missense probably damaging 1.00
R9202:Wdr89 UTSW 12 75633169 missense probably benign 0.00
R9269:Wdr89 UTSW 12 75632790 missense possibly damaging 0.50
R9340:Wdr89 UTSW 12 75633163 missense probably benign 0.11
R9522:Wdr89 UTSW 12 75633150 missense probably damaging 1.00
R9557:Wdr89 UTSW 12 75632892 missense probably damaging 1.00
R9760:Wdr89 UTSW 12 75633252 missense probably damaging 0.99
X0023:Wdr89 UTSW 12 75633177 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGCCCATCTTTCACATCGG -3'
(R):5'- TGCTGGTGCAGAGAAAGTTGAC -3'

Sequencing Primer
(F):5'- CCTGGATGTTCAAACACGTG -3'
(R):5'- AAAGTTGACGAGGATGCATTGTTG -3'
Posted On 2019-12-20