Incidental Mutation 'R7835:Fam208a'
ID605937
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27476643 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 1311 (G1311C)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450] [ENSMUST00000223689]
Predicted Effect probably damaging
Transcript: ENSMUST00000022450
AA Change: G1311C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: G1311C

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223689
Predicted Effect probably benign
Transcript: ENSMUST00000225139
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Prss21 A T 17: 23,869,451 Q130L possibly damaging Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
R7524:Fam208a UTSW 14 27466203 missense probably damaging 0.99
R7580:Fam208a UTSW 14 27466286 missense probably benign 0.29
R7726:Fam208a UTSW 14 27447497 missense probably damaging 0.99
R7771:Fam208a UTSW 14 27467559 missense probably damaging 1.00
R7782:Fam208a UTSW 14 27471944 missense probably benign 0.07
R7795:Fam208a UTSW 14 27481383 missense
R7954:Fam208a UTSW 14 27447524 critical splice donor site probably null
R7981:Fam208a UTSW 14 27446416 missense possibly damaging 0.49
R8101:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R8160:Fam208a UTSW 14 27449956 missense probably damaging 1.00
R8307:Fam208a UTSW 14 27471665 missense probably damaging 1.00
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Z1176:Fam208a UTSW 14 27429208 missense probably damaging 0.97
Z1176:Fam208a UTSW 14 27477148 missense probably damaging 1.00
Z1177:Fam208a UTSW 14 27448250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGTGATTTTCCAATACTGAGC -3'
(R):5'- TAAGCCAGTTCCCCATGAATG -3'

Sequencing Primer
(F):5'- TGTGATTTTCCAATACTGAGCAATAG -3'
(R):5'- CATGAAAATCTAGGGCAACC -3'
Posted On2019-12-20