Incidental Mutation 'R7835:Prss21'
ID605941
Institutional Source Beutler Lab
Gene Symbol Prss21
Ensembl Gene ENSMUSG00000024116
Gene Nameprotease, serine 21
SynonymsmT4, testisin, TESP5, 1700023E12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7835 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23868056-23873114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23869451 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 130 (Q130L)
Ref Sequence ENSEMBL: ENSMUSP00000024928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024928]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024928
AA Change: Q130L

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024928
Gene: ENSMUSG00000024116
AA Change: Q130L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 54 291 1.18e-94 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell-surface anchored serine protease, which is a member of the trypsin family of serine proteases. The encoded protein is predicted to be active on peptide linkages involving the carboxyl group of lysine or arginine. The encoded protein localizes to the cytoplasm and the plasma membrane of premeiotic testicular germ cells and may be involved in progression of testicular tumors of germ cell origin. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for one knock-out allele impaires fertilization of epididymal sperm only in an in vitro experiment. Mice homozygous for another knock-out allele exhibit defective sperm maturation during passage through the epididymis and decreased spermfertilization capability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,099,875 S1465T probably benign Het
Accsl T A 2: 93,865,984 K90* probably null Het
Adamts3 A T 5: 89,700,440 D674E possibly damaging Het
Adap2 T A 11: 80,160,231 V129D probably benign Het
Ank3 A G 10: 69,987,727 D742G Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C330021F23Rik A G 8: 3,580,452 probably benign Het
Cachd1 G T 4: 100,974,153 probably null Het
Ccne1 G T 7: 38,102,845 Q133K probably benign Het
Cers3 C T 7: 66,773,639 H111Y possibly damaging Het
Chst5 A T 8: 111,890,602 L129M probably damaging Het
Depdc7 A G 2: 104,728,185 S164P probably benign Het
Dnah10 G A 5: 124,777,234 A1966T probably damaging Het
Fam208a G T 14: 27,476,643 G1311C probably damaging Het
Fcgbp T G 7: 28,117,207 S2365A possibly damaging Het
Ihh A G 1: 74,946,366 V320A probably damaging Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Kif13b T A 14: 64,767,452 H1117Q probably benign Het
Lcn8 C A 2: 25,655,296 probably null Het
Lrp4 T C 2: 91,495,042 V1404A possibly damaging Het
Lrrc61 A T 6: 48,568,572 T110S probably benign Het
Mrpl19 G A 6: 81,962,126 R232C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mzt1 T C 14: 99,046,003 T21A probably benign Het
Naip6 G T 13: 100,316,004 A183E probably benign Het
Neb T C 2: 52,150,577 D6624G probably benign Het
Nup85 A G 11: 115,570,071 D183G probably benign Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr828 T A 9: 18,815,809 M162L probably benign Het
Piezo2 A T 18: 63,082,945 F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1a T C 6: 71,915,142 V135A probably benign Het
Ppcdc A G 9: 57,420,276 S83P probably benign Het
Rdx T A 9: 52,065,788 N112K probably damaging Het
Rgs22 A G 15: 36,081,911 probably null Het
Rps26 C T 10: 128,626,126 V40I probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc2 A C 4: 130,275,487 C4G unknown Het
Sh3rf2 C A 18: 42,111,170 R266S probably benign Het
Slc38a10 A G 11: 120,116,996 I386T possibly damaging Het
Stab2 G A 10: 86,872,619 P1694L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tmem102 A G 11: 69,804,345 V267A probably damaging Het
Trim65 A G 11: 116,130,929 L26P probably damaging Het
Vmn1r160 T A 7: 22,871,954 M244K possibly damaging Het
Vmn1r57 A T 7: 5,221,139 H221L probably benign Het
Wdr89 C A 12: 75,632,899 V194F probably damaging Het
Wee1 C A 7: 110,130,878 Y396* probably null Het
Zfp451 A T 1: 33,772,979 V885D probably damaging Het
Zfp981 A T 4: 146,537,876 Q419H probably benign Het
Znfx1 A G 2: 167,039,827 Y1081H probably damaging Het
Other mutations in Prss21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Prss21 APN 17 23872440 missense possibly damaging 0.48
IGL03151:Prss21 APN 17 23869402 missense probably damaging 0.98
R1136:Prss21 UTSW 17 23872994 missense probably damaging 1.00
R2299:Prss21 UTSW 17 23869589 missense probably benign 0.18
R3615:Prss21 UTSW 17 23872831 missense probably benign 0.20
R3616:Prss21 UTSW 17 23872831 missense probably benign 0.20
R4589:Prss21 UTSW 17 23872822 missense possibly damaging 0.96
R5691:Prss21 UTSW 17 23868785 splice site probably null
R6946:Prss21 UTSW 17 23868164 missense possibly damaging 0.92
R8243:Prss21 UTSW 17 23869402 missense probably damaging 0.98
R8421:Prss21 UTSW 17 23869368 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGAACGTGAGGTAGTCGTCG -3'
(R):5'- TAATGTGAAAGGTTAGGGTAGTGCC -3'

Sequencing Primer
(F):5'- TAGTCGTCGCCTCAGAGAGAG -3'
(R):5'- ACCCGTCTGTACCCAGC -3'
Posted On2019-12-20