Incidental Mutation 'R7835:Prss21'
ID 605941
Institutional Source Beutler Lab
Gene Symbol Prss21
Ensembl Gene ENSMUSG00000024116
Gene Name serine protease 21
Synonyms TESP5, mT4, 1700023E12Rik, testisin
MMRRC Submission 045889-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R7835 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 24087046-24092087 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24088425 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 130 (Q130L)
Ref Sequence ENSEMBL: ENSMUSP00000024928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024928]
AlphaFold Q9JHJ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000024928
AA Change: Q130L

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024928
Gene: ENSMUSG00000024116
AA Change: Q130L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 54 291 1.18e-94 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell-surface anchored serine protease, which is a member of the trypsin family of serine proteases. The encoded protein is predicted to be active on peptide linkages involving the carboxyl group of lysine or arginine. The encoded protein localizes to the cytoplasm and the plasma membrane of premeiotic testicular germ cells and may be involved in progression of testicular tumors of germ cell origin. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for one knock-out allele impaires fertilization of epididymal sperm only in an in vitro experiment. Mice homozygous for another knock-out allele exhibit defective sperm maturation during passage through the epididymis and decreased spermfertilization capability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 78,749,623 (GRCm39) S1465T probably benign Het
Accsl T A 2: 93,696,329 (GRCm39) K90* probably null Het
Adamts3 A T 5: 89,848,299 (GRCm39) D674E possibly damaging Het
Adap2 T A 11: 80,051,057 (GRCm39) V129D probably benign Het
Ank3 A G 10: 69,823,557 (GRCm39) D742G Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cachd1 G T 4: 100,831,350 (GRCm39) probably null Het
Ccne1 G T 7: 37,802,270 (GRCm39) Q133K probably benign Het
Cers3 C T 7: 66,423,387 (GRCm39) H111Y possibly damaging Het
Chst5 A T 8: 112,617,234 (GRCm39) L129M probably damaging Het
Depdc7 A G 2: 104,558,530 (GRCm39) S164P probably benign Het
Dnah10 G A 5: 124,854,298 (GRCm39) A1966T probably damaging Het
Fcgbp T G 7: 27,816,632 (GRCm39) S2365A possibly damaging Het
Ihh A G 1: 74,985,525 (GRCm39) V320A probably damaging Het
Kdm5d T C Y: 900,558 (GRCm39) V201A possibly damaging Het
Kif13b T A 14: 65,004,901 (GRCm39) H1117Q probably benign Het
Lcn8 C A 2: 25,545,308 (GRCm39) probably null Het
Lrp4 T C 2: 91,325,387 (GRCm39) V1404A possibly damaging Het
Lrrc61 A T 6: 48,545,506 (GRCm39) T110S probably benign Het
Mrpl19 G A 6: 81,939,107 (GRCm39) R232C probably damaging Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Mzt1 T C 14: 99,283,439 (GRCm39) T21A probably benign Het
Naip6 G T 13: 100,452,512 (GRCm39) A183E probably benign Het
Neb T C 2: 52,040,589 (GRCm39) D6624G probably benign Het
Nup85 A G 11: 115,460,897 (GRCm39) D183G probably benign Het
Olfm5 A T 7: 103,803,652 (GRCm39) Y195* probably null Het
Or7g16 T A 9: 18,727,105 (GRCm39) M162L probably benign Het
Piezo2 A T 18: 63,216,016 (GRCm39) F1216I probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Polr1a T C 6: 71,892,126 (GRCm39) V135A probably benign Het
Ppcdc A G 9: 57,327,559 (GRCm39) S83P probably benign Het
Rdx T A 9: 51,977,088 (GRCm39) N112K probably damaging Het
Rgs22 A G 15: 36,082,057 (GRCm39) probably null Het
Rps23rg1 A G 8: 3,630,452 (GRCm39) probably benign Het
Rps26 C T 10: 128,461,995 (GRCm39) V40I probably benign Het
Runx2 A T 17: 44,919,123 (GRCm39) M405K probably damaging Het
Serinc2 A C 4: 130,169,280 (GRCm39) C4G unknown Het
Sh3rf2 C A 18: 42,244,235 (GRCm39) R266S probably benign Het
Slc38a10 A G 11: 120,007,822 (GRCm39) I386T possibly damaging Het
Stab2 G A 10: 86,708,483 (GRCm39) P1694L probably benign Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tasor G T 14: 27,198,600 (GRCm39) G1311C probably damaging Het
Tmem102 A G 11: 69,695,171 (GRCm39) V267A probably damaging Het
Trim65 A G 11: 116,021,755 (GRCm39) L26P probably damaging Het
Vmn1r160 T A 7: 22,571,379 (GRCm39) M244K possibly damaging Het
Vmn1r57 A T 7: 5,224,138 (GRCm39) H221L probably benign Het
Wdr89 C A 12: 75,679,673 (GRCm39) V194F probably damaging Het
Wee1 C A 7: 109,730,085 (GRCm39) Y396* probably null Het
Zfp451 A T 1: 33,812,060 (GRCm39) V885D probably damaging Het
Zfp981 A T 4: 146,622,333 (GRCm39) Q419H probably benign Het
Znfx1 A G 2: 166,881,747 (GRCm39) Y1081H probably damaging Het
Other mutations in Prss21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Prss21 APN 17 24,091,414 (GRCm39) missense possibly damaging 0.48
IGL03151:Prss21 APN 17 24,088,376 (GRCm39) missense probably damaging 0.98
R1136:Prss21 UTSW 17 24,091,968 (GRCm39) missense probably damaging 1.00
R2299:Prss21 UTSW 17 24,088,563 (GRCm39) missense probably benign 0.18
R3615:Prss21 UTSW 17 24,091,805 (GRCm39) missense probably benign 0.20
R3616:Prss21 UTSW 17 24,091,805 (GRCm39) missense probably benign 0.20
R4589:Prss21 UTSW 17 24,091,796 (GRCm39) missense possibly damaging 0.96
R5691:Prss21 UTSW 17 24,087,759 (GRCm39) splice site probably null
R6946:Prss21 UTSW 17 24,087,138 (GRCm39) missense possibly damaging 0.92
R8243:Prss21 UTSW 17 24,088,376 (GRCm39) missense probably damaging 0.98
R8421:Prss21 UTSW 17 24,088,342 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGAACGTGAGGTAGTCGTCG -3'
(R):5'- TAATGTGAAAGGTTAGGGTAGTGCC -3'

Sequencing Primer
(F):5'- TAGTCGTCGCCTCAGAGAGAG -3'
(R):5'- ACCCGTCTGTACCCAGC -3'
Posted On 2019-12-20