Mutagenetix > Incidental Mutation

Incidental Mutation 'R7835:Piezo2'

605944

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik

MMRRC Submission

045889-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7835 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63143284-63520254 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 63216016 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 1216 (F1216I)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000047480
AA Change: F1216I

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: F1216I

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182233
AA Change: F984I

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: F984I

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	34	56	N/A	INTRINSIC
coiled coil region	223	250	N/A	INTRINSIC
transmembrane domain	272	294	N/A	INTRINSIC
transmembrane domain	307	329	N/A	INTRINSIC
SCOP:d1eq1a_	365	434	1e-3	SMART
transmembrane domain	450	472	N/A	INTRINSIC
transmembrane domain	476	498	N/A	INTRINSIC
transmembrane domain	505	527	N/A	INTRINSIC
low complexity region	540	552	N/A	INTRINSIC
transmembrane domain	559	581	N/A	INTRINSIC
low complexity region	668	689	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	744	761	N/A	INTRINSIC
transmembrane domain	768	790	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC
transmembrane domain	924	941	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183217
AA Change: F1202I

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: F1202I

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	886	907	N/A	INTRINSIC
transmembrane domain	935	957	N/A	INTRINSIC
transmembrane domain	962	979	N/A	INTRINSIC
transmembrane domain	986	1008	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC
transmembrane domain	1116	1138	N/A	INTRINSIC
transmembrane domain	1142	1159	N/A	INTRINSIC
transmembrane domain	1172	1194	N/A	INTRINSIC
transmembrane domain	1220	1242	N/A	INTRINSIC
transmembrane domain	1294	1313	N/A	INTRINSIC
transmembrane domain	1317	1339	N/A	INTRINSIC
transmembrane domain	1352	1374	N/A	INTRINSIC
coiled coil region	1460	1501	N/A	INTRINSIC
low complexity region	1528	1537	N/A	INTRINSIC
low complexity region	1558	1575	N/A	INTRINSIC

Meta Mutation Damage Score

0.0664

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	A	7: 78,749,623 (GRCm39)	S1465T	probably benign	Het
Accsl	T	A	2: 93,696,329 (GRCm39)	K90*	probably null	Het
Adamts3	A	T	5: 89,848,299 (GRCm39)	D674E	possibly damaging	Het
Adap2	T	A	11: 80,051,057 (GRCm39)	V129D	probably benign	Het
Ank3	A	G	10: 69,823,557 (GRCm39)	D742G		Het
C1ra	G	A	6: 124,494,684 (GRCm39)	E316K	probably benign	Het
Cachd1	G	T	4: 100,831,350 (GRCm39)		probably null	Het
Ccne1	G	T	7: 37,802,270 (GRCm39)	Q133K	probably benign	Het
Cers3	C	T	7: 66,423,387 (GRCm39)	H111Y	possibly damaging	Het
Chst5	A	T	8: 112,617,234 (GRCm39)	L129M	probably damaging	Het
Depdc7	A	G	2: 104,558,530 (GRCm39)	S164P	probably benign	Het
Dnah10	G	A	5: 124,854,298 (GRCm39)	A1966T	probably damaging	Het
Fcgbp	T	G	7: 27,816,632 (GRCm39)	S2365A	possibly damaging	Het
Ihh	A	G	1: 74,985,525 (GRCm39)	V320A	probably damaging	Het
Kdm5d	T	C	Y: 900,558 (GRCm39)	V201A	possibly damaging	Het
Kif13b	T	A	14: 65,004,901 (GRCm39)	H1117Q	probably benign	Het
Lcn8	C	A	2: 25,545,308 (GRCm39)		probably null	Het
Lrp4	T	C	2: 91,325,387 (GRCm39)	V1404A	possibly damaging	Het
Lrrc61	A	T	6: 48,545,506 (GRCm39)	T110S	probably benign	Het
Mrpl19	G	A	6: 81,939,107 (GRCm39)	R232C	probably damaging	Het
Muc5ac	G	C	7: 141,363,040 (GRCm39)	G2117A	unknown	Het
Mzt1	T	C	14: 99,283,439 (GRCm39)	T21A	probably benign	Het
Naip6	G	T	13: 100,452,512 (GRCm39)	A183E	probably benign	Het
Neb	T	C	2: 52,040,589 (GRCm39)	D6624G	probably benign	Het
Nup85	A	G	11: 115,460,897 (GRCm39)	D183G	probably benign	Het
Olfm5	A	T	7: 103,803,652 (GRCm39)	Y195*	probably null	Het
Or7g16	T	A	9: 18,727,105 (GRCm39)	M162L	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 110,350,827 (GRCm39)		probably benign	Het
Polr1a	T	C	6: 71,892,126 (GRCm39)	V135A	probably benign	Het
Ppcdc	A	G	9: 57,327,559 (GRCm39)	S83P	probably benign	Het
Prss21	A	T	17: 24,088,425 (GRCm39)	Q130L	possibly damaging	Het
Rdx	T	A	9: 51,977,088 (GRCm39)	N112K	probably damaging	Het
Rgs22	A	G	15: 36,082,057 (GRCm39)		probably null	Het
Rps23rg1	A	G	8: 3,630,452 (GRCm39)		probably benign	Het
Rps26	C	T	10: 128,461,995 (GRCm39)	V40I	probably benign	Het
Runx2	A	T	17: 44,919,123 (GRCm39)	M405K	probably damaging	Het
Serinc2	A	C	4: 130,169,280 (GRCm39)	C4G	unknown	Het
Sh3rf2	C	A	18: 42,244,235 (GRCm39)	R266S	probably benign	Het
Slc38a10	A	G	11: 120,007,822 (GRCm39)	I386T	possibly damaging	Het
Stab2	G	A	10: 86,708,483 (GRCm39)	P1694L	probably benign	Het
Taf4	G	A	2: 179,573,822 (GRCm39)	T682M	probably damaging	Het
Tasor	G	T	14: 27,198,600 (GRCm39)	G1311C	probably damaging	Het
Tmem102	A	G	11: 69,695,171 (GRCm39)	V267A	probably damaging	Het
Trim65	A	G	11: 116,021,755 (GRCm39)	L26P	probably damaging	Het
Vmn1r160	T	A	7: 22,571,379 (GRCm39)	M244K	possibly damaging	Het
Vmn1r57	A	T	7: 5,224,138 (GRCm39)	H221L	probably benign	Het
Wdr89	C	A	12: 75,679,673 (GRCm39)	V194F	probably damaging	Het
Wee1	C	A	7: 109,730,085 (GRCm39)	Y396*	probably null	Het
Zfp451	A	T	1: 33,812,060 (GRCm39)	V885D	probably damaging	Het
Zfp981	A	T	4: 146,622,333 (GRCm39)	Q419H	probably benign	Het
Znfx1	A	G	2: 166,881,747 (GRCm39)	Y1081H	probably damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,250,770 (GRCm39)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,155,531 (GRCm39)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,203,101 (GRCm39)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,257,685 (GRCm39)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,163,463 (GRCm39)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,315,904 (GRCm39)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,160,630 (GRCm39)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,216,241 (GRCm39)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,175,859 (GRCm39)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,225,915 (GRCm39)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,153,705 (GRCm39)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,279,915 (GRCm39)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,205,933 (GRCm39)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,165,995 (GRCm39)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,157,546 (GRCm39)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,207,730 (GRCm39)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,197,856 (GRCm39)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,257,731 (GRCm39)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,203,146 (GRCm39)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,163,343 (GRCm39)	splice site	probably null
IGL03129:Piezo2	APN	18	63,248,043 (GRCm39)	missense	probably benign
IGL03143:Piezo2	APN	18	63,241,147 (GRCm39)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,144,669 (GRCm39)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,257,677 (GRCm39)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,186,133 (GRCm39)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,174,791 (GRCm39)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,144,609 (GRCm39)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,154,379 (GRCm39)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,160,775 (GRCm39)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
sopranino	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
woodwind	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,519,271 (GRCm39)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,157,540 (GRCm39)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,235,155 (GRCm39)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,157,562 (GRCm39)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,162,132 (GRCm39)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,235,245 (GRCm39)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,157,522 (GRCm39)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,160,615 (GRCm39)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,155,552 (GRCm39)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,155,497 (GRCm39)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,152,329 (GRCm39)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,174,794 (GRCm39)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,216,306 (GRCm39)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,148,873 (GRCm39)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,219,824 (GRCm39)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,154,325 (GRCm39)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,216,202 (GRCm39)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,277,990 (GRCm39)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,215,986 (GRCm39)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,250,743 (GRCm39)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,154,244 (GRCm39)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,239,355 (GRCm39)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,241,158 (GRCm39)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,165,911 (GRCm39)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,152,415 (GRCm39)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,247,031 (GRCm39)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,211,911 (GRCm39)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,211,852 (GRCm39)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,277,997 (GRCm39)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,192,815 (GRCm39)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,252,006 (GRCm39)	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63,214,805 (GRCm39)	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63,250,791 (GRCm39)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,247,112 (GRCm39)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,239,345 (GRCm39)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63,155,596 (GRCm39)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,378,695 (GRCm39)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,186,106 (GRCm39)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,279,914 (GRCm39)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,157,506 (GRCm39)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,175,903 (GRCm39)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,214,864 (GRCm39)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,183,675 (GRCm39)	missense	probably benign
R4181:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,217,911 (GRCm39)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,235,170 (GRCm39)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,247,134 (GRCm39)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,205,951 (GRCm39)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,219,699 (GRCm39)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,203,034 (GRCm39)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,278,025 (GRCm39)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,211,862 (GRCm39)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,290,333 (GRCm39)	missense	probably benign
R4961:Piezo2	UTSW	18	63,186,032 (GRCm39)	splice site	probably null
R4968:Piezo2	UTSW	18	63,278,042 (GRCm39)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,207,751 (GRCm39)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,216,184 (GRCm39)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,157,607 (GRCm39)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,207,691 (GRCm39)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,163,480 (GRCm39)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,166,000 (GRCm39)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,197,802 (GRCm39)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,217,811 (GRCm39)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,278,176 (GRCm39)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,160,935 (GRCm39)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,144,792 (GRCm39)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,278,162 (GRCm39)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,250,768 (GRCm39)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,250,767 (GRCm39)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,279,927 (GRCm39)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,160,972 (GRCm39)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,247,005 (GRCm39)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6073:Piezo2	UTSW	18	63,145,716 (GRCm39)	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63,290,281 (GRCm39)	nonsense	probably null
R6255:Piezo2	UTSW	18	63,254,341 (GRCm39)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,250,749 (GRCm39)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,239,364 (GRCm39)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,219,678 (GRCm39)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,174,734 (GRCm39)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,239,342 (GRCm39)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,154,399 (GRCm39)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,154,333 (GRCm39)	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63,165,960 (GRCm39)	nonsense	probably null
R6855:Piezo2	UTSW	18	63,223,950 (GRCm39)	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63,166,057 (GRCm39)	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63,216,032 (GRCm39)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,278,181 (GRCm39)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,257,780 (GRCm39)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,241,101 (GRCm39)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,150,590 (GRCm39)	splice site	probably null
R7395:Piezo2	UTSW	18	63,160,634 (GRCm39)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,157,543 (GRCm39)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,145,794 (GRCm39)	missense	probably benign
R7517:Piezo2	UTSW	18	63,215,996 (GRCm39)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,186,081 (GRCm39)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,175,610 (GRCm39)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,246,947 (GRCm39)	critical splice donor site	probably null
R8014:Piezo2	UTSW	18	63,216,271 (GRCm39)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,175,882 (GRCm39)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,163,537 (GRCm39)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,208,801 (GRCm39)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,145,857 (GRCm39)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,217,759 (GRCm39)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,178,611 (GRCm39)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,279,873 (GRCm39)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,225,971 (GRCm39)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,226,086 (GRCm39)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8727:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8810:Piezo2	UTSW	18	63,248,034 (GRCm39)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,248,096 (GRCm39)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,225,902 (GRCm39)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,178,550 (GRCm39)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,250,815 (GRCm39)	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63,290,302 (GRCm39)	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63,154,372 (GRCm39)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,208,868 (GRCm39)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,157,637 (GRCm39)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,162,156 (GRCm39)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,235,236 (GRCm39)	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63,519,347 (GRCm39)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,280,016 (GRCm39)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,248,108 (GRCm39)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,197,767 (GRCm39)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,160,657 (GRCm39)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,183,681 (GRCm39)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,150,648 (GRCm39)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,203,065 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTTCAGTTGGGGAACTAAGAGC -3'
(R):5'- CAAGTACTGCTGCTTCCTGG -3'

Sequencing Primer
(F):5'- GCACTGATGCCTAACACTTG -3'
(R):5'- GGCTTGCATCATCACCTTCCAG -3'

Posted On

2019-12-20