Incidental Mutation 'R7836:Coq10b'
ID 605948
Institutional Source Beutler Lab
Gene Symbol Coq10b
Ensembl Gene ENSMUSG00000025981
Gene Name coenzyme Q10B
Synonyms 1700030I21Rik, 9530077A17Rik, 1500041J02Rik
MMRRC Submission 045890-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R7836 (G1)
Quality Score 127.008
Status Validated
Chromosome 1
Chromosomal Location 55091929-55111861 bp(+) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) T to C at 55092013 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027125] [ENSMUST00000087617]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027125
SMART Domains Protein: ENSMUSP00000027125
Gene: ENSMUSG00000025981

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 88 217 2.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087617
SMART Domains Protein: ENSMUSP00000084899
Gene: ENSMUSG00000025981

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 38 167 4.7e-25 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T G 5: 8,984,203 (GRCm39) S644R probably benign Het
Adra2a A G 19: 54,034,659 (GRCm39) E5G probably benign Het
Ankrd1 A T 19: 36,092,922 (GRCm39) V201D possibly damaging Het
Ano9 A T 7: 140,683,114 (GRCm39) V598E probably damaging Het
Apob T A 12: 8,051,885 (GRCm39) M1150K possibly damaging Het
BC005624 A T 2: 30,864,032 (GRCm39) I187N probably damaging Het
Bltp3b C T 10: 89,651,968 (GRCm39) T1381I probably benign Het
Ccl9 T C 11: 83,467,257 (GRCm39) E31G probably benign Het
Cnnm4 T A 1: 36,511,019 (GRCm39) D82E probably benign Het
Cplane1 T G 15: 8,233,241 (GRCm39) F1189V probably damaging Het
Cyb561 T C 11: 105,830,935 (GRCm39) N50S probably benign Het
Dctn4 G T 18: 60,679,348 (GRCm39) A223S probably benign Het
Dysf A G 6: 84,114,380 (GRCm39) Y1223C probably damaging Het
Eed C T 7: 89,630,022 (GRCm39) probably benign Het
Eef1g T A 19: 8,954,738 (GRCm39) V305E probably benign Het
Eif4ebp2 C A 10: 61,270,772 (GRCm39) A86S probably benign Het
Ermp1 T C 19: 29,609,788 (GRCm39) probably null Het
Hid1 T C 11: 115,249,821 (GRCm39) Y198C probably damaging Het
Hoxd1 C A 2: 74,593,816 (GRCm39) A124E probably benign Het
Hyal5 G A 6: 24,891,347 (GRCm39) C387Y probably damaging Het
Il11 A G 7: 4,778,999 (GRCm39) S103P probably damaging Het
Lgalsl2 A T 7: 5,362,507 (GRCm39) K46M probably damaging Het
Lmtk3 A C 7: 45,436,327 (GRCm39) I128L possibly damaging Het
Lrrc4b G T 7: 44,094,316 (GRCm39) probably benign Het
Magel2 T A 7: 62,028,116 (GRCm39) I340N possibly damaging Het
Mfsd14a A T 3: 116,442,200 (GRCm39) F71I possibly damaging Het
Mgarp A G 3: 51,296,487 (GRCm39) S172P probably benign Het
Mug1 T C 6: 121,847,611 (GRCm39) probably null Het
Naa15 G T 3: 51,370,688 (GRCm39) E651* probably null Het
Ndfip2 T C 14: 105,529,675 (GRCm39) V168A probably benign Het
Neb C A 2: 52,113,373 (GRCm39) probably null Het
Nfil3 A G 13: 53,121,968 (GRCm39) V312A possibly damaging Het
Nrap T C 19: 56,338,729 (GRCm39) I953V probably benign Het
Ntrk1 T A 3: 87,687,041 (GRCm39) K706* probably null Het
Nuf2 A T 1: 169,352,898 (GRCm39) F36I probably benign Het
Or51h7 T A 7: 102,591,125 (GRCm39) T220S possibly damaging Het
Or5aq7 T C 2: 86,937,861 (GRCm39) Y290C probably damaging Het
Pcdh8 T G 14: 80,006,101 (GRCm39) T821P possibly damaging Het
Ppl C T 16: 4,906,725 (GRCm39) R1190H probably damaging Het
Ptch2 C A 4: 116,962,224 (GRCm39) probably null Het
Ptdss1 A G 13: 67,081,719 (GRCm39) I50V probably benign Het
Pth2r G T 1: 65,390,722 (GRCm39) W292L probably damaging Het
Ptprd G A 4: 75,900,881 (GRCm39) T825M probably damaging Het
Ptprk T C 10: 28,449,385 (GRCm39) Y987H probably damaging Het
Qser1 T C 2: 104,606,579 (GRCm39) E1470G probably damaging Het
Rab11fip3 T C 17: 26,287,232 (GRCm39) E307G possibly damaging Het
Rims2 A G 15: 39,544,475 (GRCm39) Y1484C probably damaging Het
Rock1 A T 18: 10,097,651 (GRCm39) probably null Het
Slc15a1 T A 14: 121,718,145 (GRCm39) K245* probably null Het
Snx11 T A 11: 96,660,032 (GRCm39) E219V possibly damaging Het
Sox21 C A 14: 118,472,729 (GRCm39) E107* probably null Het
Spink5 T A 18: 44,132,888 (GRCm39) H501Q probably benign Het
Stard5 C T 7: 83,285,984 (GRCm39) T103M probably damaging Het
Stfa2l1 A T 16: 35,977,203 (GRCm39) probably benign Het
Sult1c2 A C 17: 54,271,076 (GRCm39) V185G probably damaging Het
Svs5 A G 2: 164,079,500 (GRCm39) S136P possibly damaging Het
Sytl3 T A 17: 6,982,774 (GRCm39) probably null Het
Tc2n C T 12: 101,619,112 (GRCm39) V349I possibly damaging Het
Tln1 A G 4: 43,554,309 (GRCm39) V271A probably benign Het
Tmem260 T A 14: 48,746,519 (GRCm39) S446R probably benign Het
Trim30a T C 7: 104,084,802 (GRCm39) D136G probably benign Het
Ulk4 A T 9: 120,873,885 (GRCm39) I1182N possibly damaging Het
Unc50 T G 1: 37,476,377 (GRCm39) I179S possibly damaging Het
Upb1 T A 10: 75,248,667 (GRCm39) Y57* probably null Het
Usp34 C T 11: 23,396,614 (GRCm39) T2349I Het
Vmn1r71 A G 7: 10,482,277 (GRCm39) V137A possibly damaging Het
Vmn1r85 T C 7: 12,818,698 (GRCm39) I149V probably benign Het
Vmn2r118 A G 17: 55,900,242 (GRCm39) L554P probably damaging Het
Wdr4 C G 17: 31,718,782 (GRCm39) probably null Het
Zbbx A T 3: 74,985,781 (GRCm39) S424T possibly damaging Het
Zfp207 C G 11: 80,282,726 (GRCm39) P246A probably damaging Het
Zfp414 T A 17: 33,848,962 (GRCm39) Y65* probably null Het
Zfp600 T A 4: 146,133,523 (GRCm39) N730K probably benign Het
Zfp827 T C 8: 79,912,979 (GRCm39) L1073P probably damaging Het
Zfp986 A G 4: 145,625,691 (GRCm39) K117R possibly damaging Het
Zgrf1 T A 3: 127,357,080 (GRCm39) Y769N probably damaging Het
Zup1 A T 10: 33,795,315 (GRCm39) I547N unknown Het
Other mutations in Coq10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Coq10b APN 1 55,100,468 (GRCm39) missense probably benign
IGL00697:Coq10b APN 1 55,100,424 (GRCm39) splice site probably null
R1517:Coq10b UTSW 1 55,103,416 (GRCm39) missense probably damaging 1.00
R1751:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R1767:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R2195:Coq10b UTSW 1 55,100,457 (GRCm39) missense probably damaging 1.00
R2421:Coq10b UTSW 1 55,092,136 (GRCm39) missense probably benign 0.00
R4796:Coq10b UTSW 1 55,110,957 (GRCm39) missense probably damaging 1.00
R4851:Coq10b UTSW 1 55,110,903 (GRCm39) missense probably benign 0.13
R5367:Coq10b UTSW 1 55,092,143 (GRCm39) missense probably benign
R5534:Coq10b UTSW 1 55,103,359 (GRCm39) missense possibly damaging 0.83
R5979:Coq10b UTSW 1 55,092,077 (GRCm39) missense probably benign 0.00
R7402:Coq10b UTSW 1 55,100,500 (GRCm39) missense probably benign 0.00
R7931:Coq10b UTSW 1 55,092,152 (GRCm39) splice site probably benign
R9292:Coq10b UTSW 1 55,110,868 (GRCm39) missense probably damaging 1.00
R9426:Coq10b UTSW 1 55,106,719 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CATAAGTGGCAGACTCCTGG -3'
(R):5'- ATATGAGGTGCACGCAGACC -3'

Sequencing Primer
(F):5'- AGAGCGTGTCCCGGAGATC -3'
(R):5'- TCTCCGGAGCCGACTAGG -3'
Posted On 2019-12-20