Mutagenetix > Incidental Mutation

Incidental Mutation 'R0090:Trip12'

60596

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

038377-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0090 (G1)

Quality Score

158

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 84732136 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000187733] [ENSMUST00000189670]

AlphaFold

G5E870

Predicted Effect

probably benign
Transcript: ENSMUST00000027421

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185720

Predicted Effect

probably benign
Transcript: ENSMUST00000186465

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186648

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187733

Predicted Effect

probably benign
Transcript: ENSMUST00000189670

SMART Domains

Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	138	149	N/A	INTRINSIC
low complexity region	150	167	N/A	INTRINSIC
Blast:HECTc	168	222	5e-8	BLAST
Blast:HECTc	378	434	1e-24	BLAST
HECTc	441	830	6.2e-180	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191187

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.7%
20x: 91.4%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
4933427I04Rik	A	G	4: 123,860,982	T230A	possibly damaging	Het
9230110C19Rik	T	A	9: 8,027,183	N118I	probably benign	Het
Acsm1	T	C	7: 119,662,189		probably benign	Het
Acta1	T	C	8: 123,893,657	N14S	probably damaging	Het
Aff4	A	G	11: 53,392,782	T362A	probably benign	Het
Aggf1	A	G	13: 95,364,959	I305T	probably benign	Het
Ap4b1	A	G	3: 103,820,429	D325G	possibly damaging	Het
Ap4e1	C	T	2: 127,064,985	T1055I	possibly damaging	Het
Arhgef2	A	T	3: 88,639,348	Q496L	probably damaging	Het
Arhgef28	A	G	13: 98,075,110	F122L	probably damaging	Het
Baiap3	G	A	17: 25,250,070		probably benign	Het
Casp8ap2	T	A	4: 32,640,327	H460Q	probably damaging	Het
Casz1	A	G	4: 148,933,411	T386A	probably benign	Het
Cd53	A	T	3: 106,767,409	V114E	possibly damaging	Het
Celsr2	A	G	3: 108,393,327		probably benign	Het
Chaf1b	G	T	16: 93,887,124	A88S	possibly damaging	Het
Cldn10	A	T	14: 118,874,200	Y194F	probably damaging	Het
Clec2e	A	C	6: 129,095,218		probably null	Het
Cmpk2	A	T	12: 26,478,022	T413S	probably benign	Het
Col9a1	T	A	1: 24,223,562		probably null	Het
Dchs1	G	T	7: 105,755,932	Q2468K	probably benign	Het
Ddx60	A	G	8: 61,942,293	D88G	probably damaging	Het
Dnah8	A	G	17: 30,784,090	R3588G	probably benign	Het
Ect2	T	C	3: 27,115,476	T774A	probably benign	Het
Ect2	C	T	3: 27,138,502	E431K	probably null	Het
Ern1	A	G	11: 106,405,823	V767A	probably damaging	Het
Fbln1	A	C	15: 85,224,288	E75A	possibly damaging	Het
Fgf5	C	T	5: 98,261,987	R132*	probably null	Het
Folh1	T	C	7: 86,725,868		probably benign	Het
Gdf15	A	T	8: 70,629,684	H257Q	probably damaging	Het
Ghitm	T	C	14: 37,122,219	T322A	probably benign	Het
Gm13212	A	T	4: 145,622,625	K211*	probably null	Het
Gm5709	A	G	3: 59,618,771		noncoding transcript	Het
Hbb-y	C	T	7: 103,852,743		probably null	Het
Hmcn2	A	T	2: 31,426,198	D3771V	probably damaging	Het
Hspa12a	T	C	19: 58,799,509	D627G	probably benign	Het
Idh2	T	C	7: 80,097,914	E286G	probably damaging	Het
Idh3b	C	A	2: 130,280,979	A297S	probably benign	Het
Igsf3	A	G	3: 101,435,652	E535G	probably damaging	Het
Ilf3	T	A	9: 21,395,414	D314E	probably damaging	Het
Itgb8	A	G	12: 119,202,563	S78P	probably benign	Het
Itih5	G	A	2: 10,164,684	V31I	probably benign	Het
Kcnj2	T	C	11: 111,073,027	V415A	probably benign	Het
Kin	A	G	2: 10,085,773	Q53R	possibly damaging	Het
Krt78	A	T	15: 101,947,837	M513K	probably benign	Het
Krtap4-8	A	T	11: 99,780,486		probably benign	Het
Ltbr	T	C	6: 125,309,449		probably benign	Het
Mgat4a	G	A	1: 37,490,333	T146I	probably damaging	Het
Mrps2	G	C	2: 28,468,256	W19C	probably damaging	Het
Mthfs	T	C	9: 89,211,291	S33P	probably damaging	Het
Myh6	T	C	14: 54,958,704	D546G	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Ndst2	T	C	14: 20,727,267	T553A	probably damaging	Het
Nlrp12	T	C	7: 3,240,034	E616G	probably damaging	Het
Nrde2	T	C	12: 100,129,286		probably benign	Het
Nup210l	G	A	3: 90,211,779	V1832I	probably benign	Het
Olfr1283	A	T	2: 111,369,294	I221F	probably damaging	Het
Olfr376	G	A	11: 73,375,576	V276I	probably benign	Het
Pcm1	A	T	8: 41,256,041	E9D	probably damaging	Het
Pear1	A	T	3: 87,754,342	D541E	possibly damaging	Het
Peg10	A	G	6: 4,756,063		probably benign	Het
Prss1	G	A	6: 41,461,232	R31Q	probably benign	Het
Ptpn13	T	C	5: 103,569,503	V1837A	probably damaging	Het
Rasgrp3	A	G	17: 75,498,461	D149G	probably damaging	Het
Reg3d	A	T	6: 78,378,483	H8Q	possibly damaging	Het
Rhox4f	A	C	X: 37,607,469	V15G	probably benign	Het
Sacs	T	A	14: 61,205,440	L1645H	probably damaging	Het
Slc16a5	A	T	11: 115,464,925	S71C	probably damaging	Het
Slc9a3	A	G	13: 74,158,728	E324G	probably damaging	Het
Smgc	T	C	15: 91,859,762	V574A	possibly damaging	Het
Stac3	C	T	10: 127,503,930		probably benign	Het
Supv3l1	A	G	10: 62,429,706	L685P	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tas2r125	G	T	6: 132,910,398	A250S	probably benign	Het
Tdrd6	C	T	17: 43,628,241	V639I	probably benign	Het
Thap12	T	G	7: 98,715,893	W423G	probably damaging	Het
Tmem245	T	C	4: 56,899,410	I217V	probably benign	Het
Tshz3	T	C	7: 36,768,892	V102A	probably benign	Het
Ubap1	T	C	4: 41,379,826	S347P	probably damaging	Het
Usp10	C	T	8: 119,953,196	Q612*	probably null	Het
Vmn2r72	T	C	7: 85,754,876	I36V	probably benign	Het
Vps37a	T	C	8: 40,526,989	I63T	possibly damaging	Het
Whrn	C	A	4: 63,432,732	R9L	possibly damaging	Het
Xrcc1	T	C	7: 24,570,217	Y401H	probably damaging	Het
Ylpm1	GCCTAAGCAGCAACCTAAG	GCCTAAG	12: 85,029,040		probably benign	Het
Zfhx3	G	A	8: 108,950,057	D2580N	possibly damaging	Het
Zfhx4	A	G	3: 5,243,625	N637S	probably damaging	Het
Zyg11a	A	T	4: 108,201,347		probably benign	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCTGTCCTACCAAAGGGAAGCG -3'
(R):5'- CCATTTCTTGAGCTTTGCGGCAAAC -3'

Sequencing Primer
(F):5'- GCACACTTCAGATGAGGTTTTTC -3'
(R):5'- CGGCAAACACGAGCTTTTAG -3'

Posted On

2013-07-24