Incidental Mutation 'R7836:Tln1'
ID 605963
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission 045890-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7836 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43531513-43562583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43554309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 271 (V271A)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000130353]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000030187
AA Change: V271A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: V271A

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130353
SMART Domains Protein: ENSMUSP00000119441
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:B41 1 39 9e-7 BLAST
B41 82 241 6.58e-9 SMART
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T G 5: 8,984,203 (GRCm39) S644R probably benign Het
Adra2a A G 19: 54,034,659 (GRCm39) E5G probably benign Het
Ankrd1 A T 19: 36,092,922 (GRCm39) V201D possibly damaging Het
Ano9 A T 7: 140,683,114 (GRCm39) V598E probably damaging Het
Apob T A 12: 8,051,885 (GRCm39) M1150K possibly damaging Het
BC005624 A T 2: 30,864,032 (GRCm39) I187N probably damaging Het
Bltp3b C T 10: 89,651,968 (GRCm39) T1381I probably benign Het
Ccl9 T C 11: 83,467,257 (GRCm39) E31G probably benign Het
Cnnm4 T A 1: 36,511,019 (GRCm39) D82E probably benign Het
Coq10b T C 1: 55,092,013 (GRCm39) probably benign Het
Cplane1 T G 15: 8,233,241 (GRCm39) F1189V probably damaging Het
Cyb561 T C 11: 105,830,935 (GRCm39) N50S probably benign Het
Dctn4 G T 18: 60,679,348 (GRCm39) A223S probably benign Het
Dysf A G 6: 84,114,380 (GRCm39) Y1223C probably damaging Het
Eed C T 7: 89,630,022 (GRCm39) probably benign Het
Eef1g T A 19: 8,954,738 (GRCm39) V305E probably benign Het
Eif4ebp2 C A 10: 61,270,772 (GRCm39) A86S probably benign Het
Ermp1 T C 19: 29,609,788 (GRCm39) probably null Het
Hid1 T C 11: 115,249,821 (GRCm39) Y198C probably damaging Het
Hoxd1 C A 2: 74,593,816 (GRCm39) A124E probably benign Het
Hyal5 G A 6: 24,891,347 (GRCm39) C387Y probably damaging Het
Il11 A G 7: 4,778,999 (GRCm39) S103P probably damaging Het
Lgalsl2 A T 7: 5,362,507 (GRCm39) K46M probably damaging Het
Lmtk3 A C 7: 45,436,327 (GRCm39) I128L possibly damaging Het
Lrrc4b G T 7: 44,094,316 (GRCm39) probably benign Het
Magel2 T A 7: 62,028,116 (GRCm39) I340N possibly damaging Het
Mfsd14a A T 3: 116,442,200 (GRCm39) F71I possibly damaging Het
Mgarp A G 3: 51,296,487 (GRCm39) S172P probably benign Het
Mug1 T C 6: 121,847,611 (GRCm39) probably null Het
Naa15 G T 3: 51,370,688 (GRCm39) E651* probably null Het
Ndfip2 T C 14: 105,529,675 (GRCm39) V168A probably benign Het
Neb C A 2: 52,113,373 (GRCm39) probably null Het
Nfil3 A G 13: 53,121,968 (GRCm39) V312A possibly damaging Het
Nrap T C 19: 56,338,729 (GRCm39) I953V probably benign Het
Ntrk1 T A 3: 87,687,041 (GRCm39) K706* probably null Het
Nuf2 A T 1: 169,352,898 (GRCm39) F36I probably benign Het
Or51h7 T A 7: 102,591,125 (GRCm39) T220S possibly damaging Het
Or5aq7 T C 2: 86,937,861 (GRCm39) Y290C probably damaging Het
Pcdh8 T G 14: 80,006,101 (GRCm39) T821P possibly damaging Het
Ppl C T 16: 4,906,725 (GRCm39) R1190H probably damaging Het
Ptch2 C A 4: 116,962,224 (GRCm39) probably null Het
Ptdss1 A G 13: 67,081,719 (GRCm39) I50V probably benign Het
Pth2r G T 1: 65,390,722 (GRCm39) W292L probably damaging Het
Ptprd G A 4: 75,900,881 (GRCm39) T825M probably damaging Het
Ptprk T C 10: 28,449,385 (GRCm39) Y987H probably damaging Het
Qser1 T C 2: 104,606,579 (GRCm39) E1470G probably damaging Het
Rab11fip3 T C 17: 26,287,232 (GRCm39) E307G possibly damaging Het
Rims2 A G 15: 39,544,475 (GRCm39) Y1484C probably damaging Het
Rock1 A T 18: 10,097,651 (GRCm39) probably null Het
Slc15a1 T A 14: 121,718,145 (GRCm39) K245* probably null Het
Snx11 T A 11: 96,660,032 (GRCm39) E219V possibly damaging Het
Sox21 C A 14: 118,472,729 (GRCm39) E107* probably null Het
Spink5 T A 18: 44,132,888 (GRCm39) H501Q probably benign Het
Stard5 C T 7: 83,285,984 (GRCm39) T103M probably damaging Het
Stfa2l1 A T 16: 35,977,203 (GRCm39) probably benign Het
Sult1c2 A C 17: 54,271,076 (GRCm39) V185G probably damaging Het
Svs5 A G 2: 164,079,500 (GRCm39) S136P possibly damaging Het
Sytl3 T A 17: 6,982,774 (GRCm39) probably null Het
Tc2n C T 12: 101,619,112 (GRCm39) V349I possibly damaging Het
Tmem260 T A 14: 48,746,519 (GRCm39) S446R probably benign Het
Trim30a T C 7: 104,084,802 (GRCm39) D136G probably benign Het
Ulk4 A T 9: 120,873,885 (GRCm39) I1182N possibly damaging Het
Unc50 T G 1: 37,476,377 (GRCm39) I179S possibly damaging Het
Upb1 T A 10: 75,248,667 (GRCm39) Y57* probably null Het
Usp34 C T 11: 23,396,614 (GRCm39) T2349I Het
Vmn1r71 A G 7: 10,482,277 (GRCm39) V137A possibly damaging Het
Vmn1r85 T C 7: 12,818,698 (GRCm39) I149V probably benign Het
Vmn2r118 A G 17: 55,900,242 (GRCm39) L554P probably damaging Het
Wdr4 C G 17: 31,718,782 (GRCm39) probably null Het
Zbbx A T 3: 74,985,781 (GRCm39) S424T possibly damaging Het
Zfp207 C G 11: 80,282,726 (GRCm39) P246A probably damaging Het
Zfp414 T A 17: 33,848,962 (GRCm39) Y65* probably null Het
Zfp600 T A 4: 146,133,523 (GRCm39) N730K probably benign Het
Zfp827 T C 8: 79,912,979 (GRCm39) L1073P probably damaging Het
Zfp986 A G 4: 145,625,691 (GRCm39) K117R possibly damaging Het
Zgrf1 T A 3: 127,357,080 (GRCm39) Y769N probably damaging Het
Zup1 A T 10: 33,795,315 (GRCm39) I547N unknown Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43,542,719 (GRCm39) missense probably benign 0.22
IGL00987:Tln1 APN 4 43,551,297 (GRCm39) unclassified probably benign
IGL01345:Tln1 APN 4 43,536,281 (GRCm39) missense probably damaging 1.00
IGL01456:Tln1 APN 4 43,543,432 (GRCm39) unclassified probably benign
IGL01715:Tln1 APN 4 43,555,890 (GRCm39) missense probably damaging 1.00
IGL01750:Tln1 APN 4 43,545,435 (GRCm39) missense probably damaging 1.00
IGL01933:Tln1 APN 4 43,555,894 (GRCm39) missense possibly damaging 0.52
IGL01933:Tln1 APN 4 43,539,508 (GRCm39) missense probably benign
IGL02119:Tln1 APN 4 43,546,760 (GRCm39) missense probably damaging 0.99
IGL02148:Tln1 APN 4 43,555,388 (GRCm39) missense probably damaging 1.00
IGL02153:Tln1 APN 4 43,546,857 (GRCm39) missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43,540,612 (GRCm39) missense probably benign 0.07
IGL02691:Tln1 APN 4 43,539,544 (GRCm39) missense probably benign 0.42
IGL02882:Tln1 APN 4 43,539,522 (GRCm39) missense probably benign 0.45
IGL02892:Tln1 APN 4 43,555,679 (GRCm39) missense probably damaging 1.00
IGL03061:Tln1 APN 4 43,545,694 (GRCm39) missense probably damaging 1.00
IGL03102:Tln1 APN 4 43,532,861 (GRCm39) missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43,539,084 (GRCm39) splice site probably benign
H8786:Tln1 UTSW 4 43,544,589 (GRCm39) missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43,539,998 (GRCm39) missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43,542,701 (GRCm39) critical splice donor site probably null
R0206:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0208:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0454:Tln1 UTSW 4 43,553,504 (GRCm39) missense probably benign
R0539:Tln1 UTSW 4 43,543,434 (GRCm39) critical splice donor site probably null
R0548:Tln1 UTSW 4 43,542,709 (GRCm39) missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43,550,304 (GRCm39) missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43,547,756 (GRCm39) missense probably benign 0.34
R0607:Tln1 UTSW 4 43,553,071 (GRCm39) missense probably damaging 1.00
R0609:Tln1 UTSW 4 43,544,645 (GRCm39) missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43,555,333 (GRCm39) missense probably damaging 1.00
R0993:Tln1 UTSW 4 43,549,825 (GRCm39) missense probably benign 0.22
R1255:Tln1 UTSW 4 43,538,044 (GRCm39) missense probably damaging 1.00
R1292:Tln1 UTSW 4 43,534,578 (GRCm39) critical splice donor site probably null
R1752:Tln1 UTSW 4 43,536,311 (GRCm39) missense probably damaging 1.00
R2169:Tln1 UTSW 4 43,548,005 (GRCm39) missense probably damaging 1.00
R2172:Tln1 UTSW 4 43,545,721 (GRCm39) missense probably benign
R2202:Tln1 UTSW 4 43,553,083 (GRCm39) splice site probably null
R2680:Tln1 UTSW 4 43,539,668 (GRCm39) missense probably damaging 1.00
R3012:Tln1 UTSW 4 43,542,525 (GRCm39) missense probably benign
R3714:Tln1 UTSW 4 43,540,597 (GRCm39) missense probably damaging 1.00
R3735:Tln1 UTSW 4 43,549,370 (GRCm39) missense probably damaging 0.97
R3794:Tln1 UTSW 4 43,536,295 (GRCm39) missense probably damaging 1.00
R3825:Tln1 UTSW 4 43,536,413 (GRCm39) splice site probably benign
R3983:Tln1 UTSW 4 43,553,030 (GRCm39) missense probably damaging 1.00
R4061:Tln1 UTSW 4 43,549,177 (GRCm39) missense probably damaging 1.00
R4249:Tln1 UTSW 4 43,536,104 (GRCm39) missense probably damaging 1.00
R4287:Tln1 UTSW 4 43,543,509 (GRCm39) missense probably benign 0.01
R4471:Tln1 UTSW 4 43,551,018 (GRCm39) missense probably benign 0.03
R4562:Tln1 UTSW 4 43,533,598 (GRCm39) missense probably damaging 1.00
R4654:Tln1 UTSW 4 43,535,954 (GRCm39) missense probably null 1.00
R4737:Tln1 UTSW 4 43,540,588 (GRCm39) missense probably benign 0.00
R4936:Tln1 UTSW 4 43,547,522 (GRCm39) missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43,539,406 (GRCm39) missense probably benign 0.06
R5288:Tln1 UTSW 4 43,540,661 (GRCm39) missense probably benign 0.06
R5421:Tln1 UTSW 4 43,533,609 (GRCm39) missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43,543,905 (GRCm39) missense probably benign 0.26
R5660:Tln1 UTSW 4 43,547,732 (GRCm39) missense probably damaging 1.00
R5772:Tln1 UTSW 4 43,545,191 (GRCm39) missense probably benign 0.13
R6012:Tln1 UTSW 4 43,539,508 (GRCm39) missense probably benign
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6052:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6145:Tln1 UTSW 4 43,538,030 (GRCm39) missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43,534,744 (GRCm39) missense probably benign 0.06
R6242:Tln1 UTSW 4 43,533,145 (GRCm39) missense probably damaging 1.00
R6454:Tln1 UTSW 4 43,533,866 (GRCm39) missense probably damaging 0.99
R6467:Tln1 UTSW 4 43,543,165 (GRCm39) missense probably benign 0.42
R6548:Tln1 UTSW 4 43,547,525 (GRCm39) missense probably damaging 0.98
R6576:Tln1 UTSW 4 43,555,419 (GRCm39) splice site probably null
R6722:Tln1 UTSW 4 43,547,618 (GRCm39) missense probably damaging 1.00
R6968:Tln1 UTSW 4 43,550,217 (GRCm39) missense probably benign 0.02
R7000:Tln1 UTSW 4 43,556,302 (GRCm39) missense probably damaging 0.96
R7137:Tln1 UTSW 4 43,540,616 (GRCm39) missense probably damaging 1.00
R7242:Tln1 UTSW 4 43,542,602 (GRCm39) missense probably benign 0.01
R7294:Tln1 UTSW 4 43,534,399 (GRCm39) missense probably benign 0.02
R7312:Tln1 UTSW 4 43,545,922 (GRCm39) missense probably damaging 1.00
R7547:Tln1 UTSW 4 43,545,206 (GRCm39) missense possibly damaging 0.80
R7874:Tln1 UTSW 4 43,555,606 (GRCm39) missense probably damaging 1.00
R7874:Tln1 UTSW 4 43,538,041 (GRCm39) missense probably damaging 1.00
R8030:Tln1 UTSW 4 43,535,737 (GRCm39) critical splice donor site probably null
R8105:Tln1 UTSW 4 43,538,231 (GRCm39) missense probably benign 0.32
R8212:Tln1 UTSW 4 43,555,918 (GRCm39) missense probably damaging 1.00
R8416:Tln1 UTSW 4 43,540,116 (GRCm39) missense probably benign 0.01
R8419:Tln1 UTSW 4 43,536,397 (GRCm39) missense probably damaging 1.00
R8680:Tln1 UTSW 4 43,553,041 (GRCm39) missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43,534,769 (GRCm39) splice site probably benign
R8725:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43,556,383 (GRCm39) missense probably benign
R8865:Tln1 UTSW 4 43,538,281 (GRCm39) missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9050:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9145:Tln1 UTSW 4 43,536,024 (GRCm39) missense probably damaging 1.00
R9210:Tln1 UTSW 4 43,536,119 (GRCm39) missense probably damaging 1.00
R9337:Tln1 UTSW 4 43,532,927 (GRCm39) missense probably damaging 1.00
R9346:Tln1 UTSW 4 43,546,895 (GRCm39) missense probably damaging 0.97
R9358:Tln1 UTSW 4 43,532,084 (GRCm39) missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43,542,893 (GRCm39) missense probably damaging 1.00
R9631:Tln1 UTSW 4 43,545,694 (GRCm39) missense probably damaging 1.00
R9650:Tln1 UTSW 4 43,545,912 (GRCm39) missense probably damaging 1.00
R9666:Tln1 UTSW 4 43,542,957 (GRCm39) missense probably damaging 0.96
RF021:Tln1 UTSW 4 43,555,890 (GRCm39) missense probably damaging 1.00
X0052:Tln1 UTSW 4 43,533,125 (GRCm39) critical splice donor site probably null
X0063:Tln1 UTSW 4 43,548,015 (GRCm39) nonsense probably null
Z1176:Tln1 UTSW 4 43,543,211 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGGAAATTTCACAGCTGCTGAG -3'
(R):5'- TCTTTCAGAAGCCAGTGCAGAC -3'

Sequencing Primer
(F):5'- GGCTGAAACCCACATCTTCTG -3'
(R):5'- AGTGCAGACCAGTTTCCTCAG -3'
Posted On 2019-12-20