Incidental Mutation 'R7836:Tln1'
ID605963
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7836 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43554309 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 271 (V271A)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000130353]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000030187
AA Change: V271A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: V271A

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130353
SMART Domains Protein: ENSMUSP00000119441
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:B41 1 39 9e-7 BLAST
B41 82 241 6.58e-9 SMART
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,757 F1189V probably damaging Het
Abcb4 T G 5: 8,934,203 S644R probably benign Het
Adra2a A G 19: 54,046,228 E5G probably benign Het
Ankrd1 A T 19: 36,115,522 V201D possibly damaging Het
Ano9 A T 7: 141,103,201 V598E probably damaging Het
Apob T A 12: 8,001,885 M1150K possibly damaging Het
BC005624 A T 2: 30,974,020 I187N probably damaging Het
Ccl9 T C 11: 83,576,431 E31G probably benign Het
Cnnm4 T A 1: 36,471,938 D82E probably benign Het
Coq10b T C 1: 55,052,854 probably benign Het
Cyb561 T C 11: 105,940,109 N50S probably benign Het
Dctn4 G T 18: 60,546,276 A223S probably benign Het
Dysf A G 6: 84,137,398 Y1223C probably damaging Het
Eed C T 7: 89,980,814 probably benign Het
Eef1g T A 19: 8,977,374 V305E probably benign Het
Eif4ebp2 C A 10: 61,434,993 A86S probably benign Het
Ermp1 T C 19: 29,632,388 probably null Het
Gm5065 A T 7: 5,359,508 K46M probably damaging Het
Hid1 T C 11: 115,358,995 Y198C probably damaging Het
Hoxd1 C A 2: 74,763,472 A124E probably benign Het
Hyal5 G A 6: 24,891,348 C387Y probably damaging Het
Il11 A G 7: 4,776,000 S103P probably damaging Het
Lmtk3 A C 7: 45,786,903 I128L possibly damaging Het
Lrrc4b G T 7: 44,444,892 probably benign Het
Magel2 T A 7: 62,378,368 I340N possibly damaging Het
Mfsd14a A T 3: 116,648,551 F71I possibly damaging Het
Mgarp A G 3: 51,389,066 S172P probably benign Het
Mug1 T C 6: 121,870,652 probably null Het
Naa15 G T 3: 51,463,267 E651* probably null Het
Ndfip2 T C 14: 105,292,241 V168A probably benign Het
Neb C A 2: 52,223,361 probably null Het
Nfil3 A G 13: 52,967,932 V312A possibly damaging Het
Nrap T C 19: 56,350,297 I953V probably benign Het
Ntrk1 T A 3: 87,779,734 K706* probably null Het
Nuf2 A T 1: 169,525,329 F36I probably benign Het
Olfr259 T C 2: 87,107,517 Y290C probably damaging Het
Olfr573-ps1 T A 7: 102,941,918 T220S possibly damaging Het
Pcdh8 T G 14: 79,768,661 T821P possibly damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ptch2 C A 4: 117,105,027 probably null Het
Ptdss1 A G 13: 66,933,655 I50V probably benign Het
Pth2r G T 1: 65,351,563 W292L probably damaging Het
Ptprd G A 4: 75,982,644 T825M probably damaging Het
Ptprk T C 10: 28,573,389 Y987H probably damaging Het
Qser1 T C 2: 104,776,234 E1470G probably damaging Het
Rab11fip3 T C 17: 26,068,258 E307G possibly damaging Het
Rims2 A G 15: 39,681,079 Y1484C probably damaging Het
Rock1 A T 18: 10,097,651 probably null Het
Slc15a1 T A 14: 121,480,733 K245* probably null Het
Snx11 T A 11: 96,769,206 E219V possibly damaging Het
Sox21 C A 14: 118,235,317 E107* probably null Het
Spink5 T A 18: 43,999,821 H501Q probably benign Het
Stard5 C T 7: 83,636,776 T103M probably damaging Het
Stfa2l1 A T 16: 36,156,833 probably benign Het
Sult1c1 A C 17: 53,964,048 V185G probably damaging Het
Svs2 A G 2: 164,237,580 S136P possibly damaging Het
Sytl3 T A 17: 6,715,375 probably null Het
Tc2n C T 12: 101,652,853 V349I possibly damaging Het
Tmem260 T A 14: 48,509,062 S446R probably benign Het
Trim30a T C 7: 104,435,595 D136G probably benign Het
Uhrf1bp1l C T 10: 89,816,106 T1381I probably benign Het
Ulk4 A T 9: 121,044,819 I1182N possibly damaging Het
Unc50 T G 1: 37,437,296 I179S possibly damaging Het
Upb1 T A 10: 75,412,833 Y57* probably null Het
Usp34 C T 11: 23,446,614 T2349I Het
Vmn1r71 A G 7: 10,748,350 V137A possibly damaging Het
Vmn1r85 T C 7: 13,084,771 I149V probably benign Het
Vmn2r118 A G 17: 55,593,242 L554P probably damaging Het
Wdr4 C G 17: 31,499,808 probably null Het
Zbbx A T 3: 75,078,474 S424T possibly damaging Het
Zfp207 C G 11: 80,391,900 P246A probably damaging Het
Zfp414 T A 17: 33,629,988 Y65* probably null Het
Zfp600 T A 4: 146,196,953 N730K probably benign Het
Zfp827 T C 8: 79,186,350 L1073P probably damaging Het
Zfp986 A G 4: 145,899,121 K117R possibly damaging Het
Zgrf1 T A 3: 127,563,431 Y769N probably damaging Het
Zufsp A T 10: 33,919,319 I547N unknown Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
R7547:Tln1 UTSW 4 43545206 missense possibly damaging 0.80
R7874:Tln1 UTSW 4 43538041 missense probably damaging 1.00
R7874:Tln1 UTSW 4 43555606 missense probably damaging 1.00
R7919:Tln1 UTSW 4 43554309 missense probably benign 0.01
R7949:Tln1 UTSW 4 43536148 splice site probably null
R7957:Tln1 UTSW 4 43538041 missense probably damaging 1.00
R7957:Tln1 UTSW 4 43555606 missense probably damaging 1.00
R8030:Tln1 UTSW 4 43535737 critical splice donor site probably null
R8105:Tln1 UTSW 4 43538231 missense probably benign 0.32
RF021:Tln1 UTSW 4 43555890 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Z1176:Tln1 UTSW 4 43543211 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGGAAATTTCACAGCTGCTGAG -3'
(R):5'- TCTTTCAGAAGCCAGTGCAGAC -3'

Sequencing Primer
(F):5'- GGCTGAAACCCACATCTTCTG -3'
(R):5'- AGTGCAGACCAGTTTCCTCAG -3'
Posted On2019-12-20