Incidental Mutation 'R7836:Mug1'
ID605970
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Namemurinoglobulin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7836 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location121838541-121889057 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121870652 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
Predicted Effect probably null
Transcript: ENSMUST00000032228
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,757 F1189V probably damaging Het
Abcb4 T G 5: 8,934,203 S644R probably benign Het
Adra2a A G 19: 54,046,228 E5G probably benign Het
Ankrd1 A T 19: 36,115,522 V201D possibly damaging Het
Ano9 A T 7: 141,103,201 V598E probably damaging Het
Apob T A 12: 8,001,885 M1150K possibly damaging Het
BC005624 A T 2: 30,974,020 I187N probably damaging Het
Ccl9 T C 11: 83,576,431 E31G probably benign Het
Cnnm4 T A 1: 36,471,938 D82E probably benign Het
Coq10b T C 1: 55,052,854 probably benign Het
Cyb561 T C 11: 105,940,109 N50S probably benign Het
Dctn4 G T 18: 60,546,276 A223S probably benign Het
Dysf A G 6: 84,137,398 Y1223C probably damaging Het
Eed C T 7: 89,980,814 probably benign Het
Eef1g T A 19: 8,977,374 V305E probably benign Het
Eif4ebp2 C A 10: 61,434,993 A86S probably benign Het
Ermp1 T C 19: 29,632,388 probably null Het
Gm5065 A T 7: 5,359,508 K46M probably damaging Het
Hid1 T C 11: 115,358,995 Y198C probably damaging Het
Hoxd1 C A 2: 74,763,472 A124E probably benign Het
Hyal5 G A 6: 24,891,348 C387Y probably damaging Het
Il11 A G 7: 4,776,000 S103P probably damaging Het
Lmtk3 A C 7: 45,786,903 I128L possibly damaging Het
Lrrc4b G T 7: 44,444,892 probably benign Het
Magel2 T A 7: 62,378,368 I340N possibly damaging Het
Mfsd14a A T 3: 116,648,551 F71I possibly damaging Het
Mgarp A G 3: 51,389,066 S172P probably benign Het
Naa15 G T 3: 51,463,267 E651* probably null Het
Ndfip2 T C 14: 105,292,241 V168A probably benign Het
Neb C A 2: 52,223,361 probably null Het
Nfil3 A G 13: 52,967,932 V312A possibly damaging Het
Nrap T C 19: 56,350,297 I953V probably benign Het
Ntrk1 T A 3: 87,779,734 K706* probably null Het
Nuf2 A T 1: 169,525,329 F36I probably benign Het
Olfr259 T C 2: 87,107,517 Y290C probably damaging Het
Olfr573-ps1 T A 7: 102,941,918 T220S possibly damaging Het
Pcdh8 T G 14: 79,768,661 T821P possibly damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ptch2 C A 4: 117,105,027 probably null Het
Ptdss1 A G 13: 66,933,655 I50V probably benign Het
Pth2r G T 1: 65,351,563 W292L probably damaging Het
Ptprd G A 4: 75,982,644 T825M probably damaging Het
Ptprk T C 10: 28,573,389 Y987H probably damaging Het
Qser1 T C 2: 104,776,234 E1470G probably damaging Het
Rab11fip3 T C 17: 26,068,258 E307G possibly damaging Het
Rims2 A G 15: 39,681,079 Y1484C probably damaging Het
Rock1 A T 18: 10,097,651 probably null Het
Slc15a1 T A 14: 121,480,733 K245* probably null Het
Snx11 T A 11: 96,769,206 E219V possibly damaging Het
Sox21 C A 14: 118,235,317 E107* probably null Het
Spink5 T A 18: 43,999,821 H501Q probably benign Het
Stard5 C T 7: 83,636,776 T103M probably damaging Het
Stfa2l1 A T 16: 36,156,833 probably benign Het
Sult1c1 A C 17: 53,964,048 V185G probably damaging Het
Svs2 A G 2: 164,237,580 S136P possibly damaging Het
Sytl3 T A 17: 6,715,375 probably null Het
Tc2n C T 12: 101,652,853 V349I possibly damaging Het
Tln1 A G 4: 43,554,309 V271A probably benign Het
Tmem260 T A 14: 48,509,062 S446R probably benign Het
Trim30a T C 7: 104,435,595 D136G probably benign Het
Uhrf1bp1l C T 10: 89,816,106 T1381I probably benign Het
Ulk4 A T 9: 121,044,819 I1182N possibly damaging Het
Unc50 T G 1: 37,437,296 I179S possibly damaging Het
Upb1 T A 10: 75,412,833 Y57* probably null Het
Usp34 C T 11: 23,446,614 T2349I Het
Vmn1r71 A G 7: 10,748,350 V137A possibly damaging Het
Vmn1r85 T C 7: 13,084,771 I149V probably benign Het
Vmn2r118 A G 17: 55,593,242 L554P probably damaging Het
Wdr4 C G 17: 31,499,808 probably null Het
Zbbx A T 3: 75,078,474 S424T possibly damaging Het
Zfp207 C G 11: 80,391,900 P246A probably damaging Het
Zfp414 T A 17: 33,629,988 Y65* probably null Het
Zfp600 T A 4: 146,196,953 N730K probably benign Het
Zfp827 T C 8: 79,186,350 L1073P probably damaging Het
Zfp986 A G 4: 145,899,121 K117R possibly damaging Het
Zgrf1 T A 3: 127,563,431 Y769N probably damaging Het
Zufsp A T 10: 33,919,319 I547N unknown Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121865809 missense probably damaging 1.00
IGL00485:Mug1 APN 6 121887416 missense probably benign 0.17
IGL00816:Mug1 APN 6 121882638 missense probably damaging 0.99
IGL01140:Mug1 APN 6 121882734 missense probably benign 0.01
IGL01141:Mug1 APN 6 121870499 missense probably benign 0.08
IGL01384:Mug1 APN 6 121849474 splice site probably benign
IGL01659:Mug1 APN 6 121870660 splice site probably benign
IGL02049:Mug1 APN 6 121871336 missense probably benign
IGL02151:Mug1 APN 6 121884690 critical splice donor site probably null
IGL02315:Mug1 APN 6 121840167 missense probably benign
IGL02629:Mug1 APN 6 121840065 missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121882585 missense probably benign 0.14
IGL02807:Mug1 APN 6 121886572 missense probably damaging 0.96
IGL02932:Mug1 APN 6 121887427 missense probably benign 0.35
IGL03232:Mug1 APN 6 121878535 missense probably benign 0.00
R1462_Mug1_304 UTSW 6 121882629 missense probably benign 0.41
R2341_Mug1_749 UTSW 6 121884629 missense probably benign 0.06
R4261_Mug1_652 UTSW 6 121873734 missense probably benign
R6173_mug1_139 UTSW 6 121863793 missense probably damaging 0.99
IGL03050:Mug1 UTSW 6 121880571 missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121884247 missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121840107 missense probably damaging 0.98
R0196:Mug1 UTSW 6 121838725 critical splice donor site probably null
R0325:Mug1 UTSW 6 121849842 missense probably benign
R0332:Mug1 UTSW 6 121849897 splice site probably null
R0377:Mug1 UTSW 6 121857361 missense probably benign 0.02
R0393:Mug1 UTSW 6 121849850 missense possibly damaging 0.64
R0414:Mug1 UTSW 6 121856554 missense probably benign 0.00
R0457:Mug1 UTSW 6 121861555 missense probably benign 0.06
R0479:Mug1 UTSW 6 121840227 missense probably benign
R0519:Mug1 UTSW 6 121851424 missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121851454 missense probably benign
R0745:Mug1 UTSW 6 121887427 missense probably benign 0.35
R0939:Mug1 UTSW 6 121884349 missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121878539 missense probably damaging 0.99
R1033:Mug1 UTSW 6 121880551 missense probably damaging 0.99
R1086:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R1116:Mug1 UTSW 6 121870645 missense probably benign
R1131:Mug1 UTSW 6 121861185 missense probably benign 0.18
R1249:Mug1 UTSW 6 121849461 missense probably benign 0.07
R1364:Mug1 UTSW 6 121881713 missense probably damaging 1.00
R1418:Mug1 UTSW 6 121838676 missense probably benign 0.00
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1494:Mug1 UTSW 6 121879300 missense probably damaging 1.00
R1639:Mug1 UTSW 6 121880571 missense probably damaging 1.00
R1901:Mug1 UTSW 6 121881821 missense probably benign
R1902:Mug1 UTSW 6 121881821 missense probably benign
R2087:Mug1 UTSW 6 121856291 missense probably benign 0.00
R2168:Mug1 UTSW 6 121870499 missense probably benign 0.08
R2249:Mug1 UTSW 6 121870510 missense probably benign
R2341:Mug1 UTSW 6 121884629 missense probably benign 0.06
R2888:Mug1 UTSW 6 121881843 missense probably benign 0.44
R2892:Mug1 UTSW 6 121840070 missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121888556 splice site probably benign
R3789:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3790:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3950:Mug1 UTSW 6 121878530 missense probably damaging 1.00
R4261:Mug1 UTSW 6 121873734 missense probably benign
R4402:Mug1 UTSW 6 121879352 missense probably damaging 1.00
R4589:Mug1 UTSW 6 121857351 missense probably benign 0.19
R4707:Mug1 UTSW 6 121884641 missense probably damaging 1.00
R4766:Mug1 UTSW 6 121884254 missense probably benign 0.01
R4840:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R4984:Mug1 UTSW 6 121838617 utr 5 prime probably benign
R4999:Mug1 UTSW 6 121878943 nonsense probably null
R5198:Mug1 UTSW 6 121874562 missense probably damaging 1.00
R5220:Mug1 UTSW 6 121861133 missense probably benign 0.03
R5253:Mug1 UTSW 6 121888913 missense probably benign 0.03
R5273:Mug1 UTSW 6 121873789 missense probably damaging 0.99
R5285:Mug1 UTSW 6 121841107 missense probably benign 0.45
R5387:Mug1 UTSW 6 121884394 missense probably damaging 0.99
R5560:Mug1 UTSW 6 121861073 missense probably damaging 0.96
R5652:Mug1 UTSW 6 121840181 missense probably benign
R5704:Mug1 UTSW 6 121851433 missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121878493 missense probably benign 0.00
R6053:Mug1 UTSW 6 121865738 missense probably benign 0.00
R6173:Mug1 UTSW 6 121863793 missense probably damaging 0.99
R6578:Mug1 UTSW 6 121887452 missense probably benign 0.00
R6647:Mug1 UTSW 6 121840241 missense probably benign 0.02
R6681:Mug1 UTSW 6 121838724 missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121881787 missense probably damaging 1.00
R7014:Mug1 UTSW 6 121861125 missense probably benign 0.22
R7031:Mug1 UTSW 6 121838714 missense probably benign 0.00
R7034:Mug1 UTSW 6 121873644 missense probably benign 0.00
R7156:Mug1 UTSW 6 121880905 missense probably damaging 1.00
R7156:Mug1 UTSW 6 121884343 missense probably damaging 1.00
R7179:Mug1 UTSW 6 121857420 missense probably benign 0.00
R7211:Mug1 UTSW 6 121880539 missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7462:Mug1 UTSW 6 121875440 missense probably benign 0.00
R7479:Mug1 UTSW 6 121878508 missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121875517 missense probably damaging 1.00
R7611:Mug1 UTSW 6 121875428 critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121856288 missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121878985 missense possibly damaging 0.79
R7867:Mug1 UTSW 6 121873634 missense probably benign
R7904:Mug1 UTSW 6 121851465 missense probably benign
R7937:Mug1 UTSW 6 121861169 missense probably benign 0.00
R7981:Mug1 UTSW 6 121881764 missense probably damaging 1.00
R7999:Mug1 UTSW 6 121880896 missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121875879 missense probably benign 0.26
R8071:Mug1 UTSW 6 121873672 missense probably benign
R8151:Mug1 UTSW 6 121841158 missense probably benign 0.01
R8491:Mug1 UTSW 6 121882729 missense probably damaging 1.00
R8714:Mug1 UTSW 6 121882722 missense probably benign 0.01
R8734:Mug1 UTSW 6 121871381 missense probably benign 0.00
R8807:Mug1 UTSW 6 121874475 missense probably benign 0.27
R8931:Mug1 UTSW 6 121884337 missense probably benign
R8940:Mug1 UTSW 6 121881683 missense
RF017:Mug1 UTSW 6 121884574 missense probably damaging 1.00
X0064:Mug1 UTSW 6 121861215 missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121841294 missense probably benign 0.32
Z1176:Mug1 UTSW 6 121880493 missense probably damaging 1.00
Z1177:Mug1 UTSW 6 121863808 missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121879299 critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121886568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTAACTCGGAAATATGCACCC -3'
(R):5'- AGACTGGCCACTTTCCAAG -3'

Sequencing Primer
(F):5'- TCGGAAATATGCACCCCCATATC -3'
(R):5'- GACTGGCCACTTTCCAAGATGTAG -3'
Posted On2019-12-20