Mutagenetix > Incidental Mutation

Incidental Mutation 'R7836:Usp34'

605990

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R7836 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 23446614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 2349 (T2349I)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130131
AA Change: T571I

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342
AA Change: T571I

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
Pfam:UCH	171	514	1.1e-48	PFAM
Pfam:UCH_1	172	470	1.6e-25	PFAM
low complexity region	763	785	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: T2349I

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000180046
AA Change: T2330I

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: T2330I

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (76/77)

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	G	15: 8,203,757	F1189V	probably damaging	Het
Abcb4	T	G	5: 8,934,203	S644R	probably benign	Het
Adra2a	A	G	19: 54,046,228	E5G	probably benign	Het
Ankrd1	A	T	19: 36,115,522	V201D	possibly damaging	Het
Ano9	A	T	7: 141,103,201	V598E	probably damaging	Het
Apob	T	A	12: 8,001,885	M1150K	possibly damaging	Het
BC005624	A	T	2: 30,974,020	I187N	probably damaging	Het
Ccl9	T	C	11: 83,576,431	E31G	probably benign	Het
Cnnm4	T	A	1: 36,471,938	D82E	probably benign	Het
Coq10b	T	C	1: 55,052,854		probably benign	Het
Cyb561	T	C	11: 105,940,109	N50S	probably benign	Het
Dctn4	G	T	18: 60,546,276	A223S	probably benign	Het
Dysf	A	G	6: 84,137,398	Y1223C	probably damaging	Het
Eed	C	T	7: 89,980,814		probably benign	Het
Eef1g	T	A	19: 8,977,374	V305E	probably benign	Het
Eif4ebp2	C	A	10: 61,434,993	A86S	probably benign	Het
Ermp1	T	C	19: 29,632,388		probably null	Het
Gm5065	A	T	7: 5,359,508	K46M	probably damaging	Het
Hid1	T	C	11: 115,358,995	Y198C	probably damaging	Het
Hoxd1	C	A	2: 74,763,472	A124E	probably benign	Het
Hyal5	G	A	6: 24,891,348	C387Y	probably damaging	Het
Il11	A	G	7: 4,776,000	S103P	probably damaging	Het
Lmtk3	A	C	7: 45,786,903	I128L	possibly damaging	Het
Lrrc4b	G	T	7: 44,444,892		probably benign	Het
Magel2	T	A	7: 62,378,368	I340N	possibly damaging	Het
Mfsd14a	A	T	3: 116,648,551	F71I	possibly damaging	Het
Mgarp	A	G	3: 51,389,066	S172P	probably benign	Het
Mug1	T	C	6: 121,870,652		probably null	Het
Naa15	G	T	3: 51,463,267	E651*	probably null	Het
Ndfip2	T	C	14: 105,292,241	V168A	probably benign	Het
Neb	C	A	2: 52,223,361		probably null	Het
Nfil3	A	G	13: 52,967,932	V312A	possibly damaging	Het
Nrap	T	C	19: 56,350,297	I953V	probably benign	Het
Ntrk1	T	A	3: 87,779,734	K706*	probably null	Het
Nuf2	A	T	1: 169,525,329	F36I	probably benign	Het
Olfr259	T	C	2: 87,107,517	Y290C	probably damaging	Het
Olfr573-ps1	T	A	7: 102,941,918	T220S	possibly damaging	Het
Pcdh8	T	G	14: 79,768,661	T821P	possibly damaging	Het
Ppl	C	T	16: 5,088,861	R1190H	probably damaging	Het
Ptch2	C	A	4: 117,105,027		probably null	Het
Ptdss1	A	G	13: 66,933,655	I50V	probably benign	Het
Pth2r	G	T	1: 65,351,563	W292L	probably damaging	Het
Ptprd	G	A	4: 75,982,644	T825M	probably damaging	Het
Ptprk	T	C	10: 28,573,389	Y987H	probably damaging	Het
Qser1	T	C	2: 104,776,234	E1470G	probably damaging	Het
Rab11fip3	T	C	17: 26,068,258	E307G	possibly damaging	Het
Rims2	A	G	15: 39,681,079	Y1484C	probably damaging	Het
Rock1	A	T	18: 10,097,651		probably null	Het
Slc15a1	T	A	14: 121,480,733	K245*	probably null	Het
Snx11	T	A	11: 96,769,206	E219V	possibly damaging	Het
Sox21	C	A	14: 118,235,317	E107*	probably null	Het
Spink5	T	A	18: 43,999,821	H501Q	probably benign	Het
Stard5	C	T	7: 83,636,776	T103M	probably damaging	Het
Stfa2l1	A	T	16: 36,156,833		probably benign	Het
Sult1c1	A	C	17: 53,964,048	V185G	probably damaging	Het
Svs2	A	G	2: 164,237,580	S136P	possibly damaging	Het
Sytl3	T	A	17: 6,715,375		probably null	Het
Tc2n	C	T	12: 101,652,853	V349I	possibly damaging	Het
Tln1	A	G	4: 43,554,309	V271A	probably benign	Het
Tmem260	T	A	14: 48,509,062	S446R	probably benign	Het
Trim30a	T	C	7: 104,435,595	D136G	probably benign	Het
Uhrf1bp1l	C	T	10: 89,816,106	T1381I	probably benign	Het
Ulk4	A	T	9: 121,044,819	I1182N	possibly damaging	Het
Unc50	T	G	1: 37,437,296	I179S	possibly damaging	Het
Upb1	T	A	10: 75,412,833	Y57*	probably null	Het
Vmn1r71	A	G	7: 10,748,350	V137A	possibly damaging	Het
Vmn1r85	T	C	7: 13,084,771	I149V	probably benign	Het
Vmn2r118	A	G	17: 55,593,242	L554P	probably damaging	Het
Wdr4	C	G	17: 31,499,808		probably null	Het
Zbbx	A	T	3: 75,078,474	S424T	possibly damaging	Het
Zfp207	C	G	11: 80,391,900	P246A	probably damaging	Het
Zfp414	T	A	17: 33,629,988	Y65*	probably null	Het
Zfp600	T	A	4: 146,196,953	N730K	probably benign	Het
Zfp827	T	C	8: 79,186,350	L1073P	probably damaging	Het
Zfp986	A	G	4: 145,899,121	K117R	possibly damaging	Het
Zgrf1	T	A	3: 127,563,431	Y769N	probably damaging	Het
Zufsp	A	T	10: 33,919,319	I547N	unknown	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGTGGATTTGGCATGATAAC -3'
(R):5'- AATCCACTGAAGCATTGTTGGC -3'

Sequencing Primer
(F):5'- TGAACACACTTATTTTGGGT -3'
(R):5'- CTGACAAAGCTATCCGAG -3'

Posted On

2019-12-20