Incidental Mutation 'R7836:Tmem260'
ID 606000
Institutional Source Beutler Lab
Gene Symbol Tmem260
Ensembl Gene ENSMUSG00000036339
Gene Name transmembrane protein 260
Synonyms 6720456H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7836 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 48446124-48524246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48509062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 446 (S446R)
Ref Sequence ENSEMBL: ENSMUSP00000118376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111735] [ENSMUST00000124720] [ENSMUST00000153765] [ENSMUST00000226422] [ENSMUST00000227440]
AlphaFold Q8BMD6
Predicted Effect probably benign
Transcript: ENSMUST00000111735
AA Change: S598R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107364
Gene: ENSMUSG00000036339
AA Change: S598R

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 211 1.9e-43 PFAM
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 353 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124720
AA Change: S446R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118376
Gene: ENSMUSG00000036339
AA Change: S446R

DomainStartEndE-ValueType
Pfam:DUF2723 1 61 4.6e-9 PFAM
transmembrane domain 65 87 N/A INTRINSIC
transmembrane domain 164 186 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153765
SMART Domains Protein: ENSMUSP00000116155
Gene: ENSMUSG00000036339

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 111 8.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226422
AA Change: S598R

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000227440
AA Change: S598R

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,757 F1189V probably damaging Het
Abcb4 T G 5: 8,934,203 S644R probably benign Het
Adra2a A G 19: 54,046,228 E5G probably benign Het
Ankrd1 A T 19: 36,115,522 V201D possibly damaging Het
Ano9 A T 7: 141,103,201 V598E probably damaging Het
Apob T A 12: 8,001,885 M1150K possibly damaging Het
BC005624 A T 2: 30,974,020 I187N probably damaging Het
Ccl9 T C 11: 83,576,431 E31G probably benign Het
Cnnm4 T A 1: 36,471,938 D82E probably benign Het
Coq10b T C 1: 55,052,854 probably benign Het
Cyb561 T C 11: 105,940,109 N50S probably benign Het
Dctn4 G T 18: 60,546,276 A223S probably benign Het
Dysf A G 6: 84,137,398 Y1223C probably damaging Het
Eed C T 7: 89,980,814 probably benign Het
Eef1g T A 19: 8,977,374 V305E probably benign Het
Eif4ebp2 C A 10: 61,434,993 A86S probably benign Het
Ermp1 T C 19: 29,632,388 probably null Het
Gm5065 A T 7: 5,359,508 K46M probably damaging Het
Hid1 T C 11: 115,358,995 Y198C probably damaging Het
Hoxd1 C A 2: 74,763,472 A124E probably benign Het
Hyal5 G A 6: 24,891,348 C387Y probably damaging Het
Il11 A G 7: 4,776,000 S103P probably damaging Het
Lmtk3 A C 7: 45,786,903 I128L possibly damaging Het
Lrrc4b G T 7: 44,444,892 probably benign Het
Magel2 T A 7: 62,378,368 I340N possibly damaging Het
Mfsd14a A T 3: 116,648,551 F71I possibly damaging Het
Mgarp A G 3: 51,389,066 S172P probably benign Het
Mug1 T C 6: 121,870,652 probably null Het
Naa15 G T 3: 51,463,267 E651* probably null Het
Ndfip2 T C 14: 105,292,241 V168A probably benign Het
Neb C A 2: 52,223,361 probably null Het
Nfil3 A G 13: 52,967,932 V312A possibly damaging Het
Nrap T C 19: 56,350,297 I953V probably benign Het
Ntrk1 T A 3: 87,779,734 K706* probably null Het
Nuf2 A T 1: 169,525,329 F36I probably benign Het
Olfr259 T C 2: 87,107,517 Y290C probably damaging Het
Olfr573-ps1 T A 7: 102,941,918 T220S possibly damaging Het
Pcdh8 T G 14: 79,768,661 T821P possibly damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ptch2 C A 4: 117,105,027 probably null Het
Ptdss1 A G 13: 66,933,655 I50V probably benign Het
Pth2r G T 1: 65,351,563 W292L probably damaging Het
Ptprd G A 4: 75,982,644 T825M probably damaging Het
Ptprk T C 10: 28,573,389 Y987H probably damaging Het
Qser1 T C 2: 104,776,234 E1470G probably damaging Het
Rab11fip3 T C 17: 26,068,258 E307G possibly damaging Het
Rims2 A G 15: 39,681,079 Y1484C probably damaging Het
Rock1 A T 18: 10,097,651 probably null Het
Slc15a1 T A 14: 121,480,733 K245* probably null Het
Snx11 T A 11: 96,769,206 E219V possibly damaging Het
Sox21 C A 14: 118,235,317 E107* probably null Het
Spink5 T A 18: 43,999,821 H501Q probably benign Het
Stard5 C T 7: 83,636,776 T103M probably damaging Het
Stfa2l1 A T 16: 36,156,833 probably benign Het
Sult1c1 A C 17: 53,964,048 V185G probably damaging Het
Svs2 A G 2: 164,237,580 S136P possibly damaging Het
Sytl3 T A 17: 6,715,375 probably null Het
Tc2n C T 12: 101,652,853 V349I possibly damaging Het
Tln1 A G 4: 43,554,309 V271A probably benign Het
Trim30a T C 7: 104,435,595 D136G probably benign Het
Uhrf1bp1l C T 10: 89,816,106 T1381I probably benign Het
Ulk4 A T 9: 121,044,819 I1182N possibly damaging Het
Unc50 T G 1: 37,437,296 I179S possibly damaging Het
Upb1 T A 10: 75,412,833 Y57* probably null Het
Usp34 C T 11: 23,446,614 T2349I Het
Vmn1r71 A G 7: 10,748,350 V137A possibly damaging Het
Vmn1r85 T C 7: 13,084,771 I149V probably benign Het
Vmn2r118 A G 17: 55,593,242 L554P probably damaging Het
Wdr4 C G 17: 31,499,808 probably null Het
Zbbx A T 3: 75,078,474 S424T possibly damaging Het
Zfp207 C G 11: 80,391,900 P246A probably damaging Het
Zfp414 T A 17: 33,629,988 Y65* probably null Het
Zfp600 T A 4: 146,196,953 N730K probably benign Het
Zfp827 T C 8: 79,186,350 L1073P probably damaging Het
Zfp986 A G 4: 145,899,121 K117R possibly damaging Het
Zgrf1 T A 3: 127,563,431 Y769N probably damaging Het
Zufsp A T 10: 33,919,319 I547N unknown Het
Other mutations in Tmem260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tmem260 APN 14 48486879 missense probably benign 0.27
IGL00338:Tmem260 APN 14 48477636 missense probably damaging 0.97
IGL00508:Tmem260 APN 14 48509121 missense probably damaging 0.99
IGL01308:Tmem260 APN 14 48511958 missense probably damaging 1.00
IGL01548:Tmem260 APN 14 48480325 missense possibly damaging 0.60
IGL01952:Tmem260 APN 14 48472476 missense probably damaging 1.00
IGL03068:Tmem260 APN 14 48486914 splice site probably benign
IGL03081:Tmem260 APN 14 48496293 missense probably benign 0.14
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0132:Tmem260 UTSW 14 48483322 nonsense probably null
R0149:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0361:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0396:Tmem260 UTSW 14 48486867 missense possibly damaging 0.83
R0524:Tmem260 UTSW 14 48472478 missense probably benign 0.00
R1734:Tmem260 UTSW 14 48509093 missense probably benign 0.00
R2152:Tmem260 UTSW 14 48477609 missense possibly damaging 0.62
R2474:Tmem260 UTSW 14 48496324 missense probably null 0.90
R2928:Tmem260 UTSW 14 48486750 missense probably damaging 1.00
R2999:Tmem260 UTSW 14 48484989 missense possibly damaging 0.92
R3030:Tmem260 UTSW 14 48485001 missense probably damaging 1.00
R4273:Tmem260 UTSW 14 48505304 missense probably benign 0.11
R4276:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4277:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4278:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4791:Tmem260 UTSW 14 48511994 intron probably benign
R4792:Tmem260 UTSW 14 48511994 intron probably benign
R4810:Tmem260 UTSW 14 48472473 missense probably damaging 0.99
R5189:Tmem260 UTSW 14 48509116 missense probably benign 0.01
R5280:Tmem260 UTSW 14 48505259 missense probably benign 0.02
R5289:Tmem260 UTSW 14 48486810 missense possibly damaging 0.79
R5322:Tmem260 UTSW 14 48486849 missense probably damaging 0.99
R5491:Tmem260 UTSW 14 48512170 splice site probably null
R5593:Tmem260 UTSW 14 48474044 missense probably benign 0.38
R5606:Tmem260 UTSW 14 48484980 missense probably damaging 1.00
R5824:Tmem260 UTSW 14 48505328 missense probably damaging 1.00
R5947:Tmem260 UTSW 14 48486801 missense possibly damaging 0.93
R6587:Tmem260 UTSW 14 48496456 splice site probably null
R7234:Tmem260 UTSW 14 48505329 nonsense probably null
R7236:Tmem260 UTSW 14 48509190 splice site probably null
R8795:Tmem260 UTSW 14 48451913 missense probably damaging 1.00
R8895:Tmem260 UTSW 14 48500388 unclassified probably benign
R9056:Tmem260 UTSW 14 48480317 missense probably benign
R9096:Tmem260 UTSW 14 48520346 missense unknown
R9384:Tmem260 UTSW 14 48486819 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAACCACACAGTGATGAGC -3'
(R):5'- AATGCTCAAGACAACCTGGGC -3'

Sequencing Primer
(F):5'- GTGATGAGCCTTTTCCCAAAAC -3'
(R):5'- CTCAAGACAACCTGGGCATGAG -3'
Posted On 2019-12-20