Mutagenetix > Incidental Mutation

Incidental Mutation 'R7836:Slc15a1'

606004

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R7836 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 121480733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 245 (K245*)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

AlphaFold

Q9JIP7

Predicted Effect

probably null
Transcript: ENSMUST00000088386
AA Change: K245*

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: K245*

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	G	15: 8,203,757	F1189V	probably damaging	Het
Abcb4	T	G	5: 8,934,203	S644R	probably benign	Het
Adra2a	A	G	19: 54,046,228	E5G	probably benign	Het
Ankrd1	A	T	19: 36,115,522	V201D	possibly damaging	Het
Ano9	A	T	7: 141,103,201	V598E	probably damaging	Het
Apob	T	A	12: 8,001,885	M1150K	possibly damaging	Het
BC005624	A	T	2: 30,974,020	I187N	probably damaging	Het
Ccl9	T	C	11: 83,576,431	E31G	probably benign	Het
Cnnm4	T	A	1: 36,471,938	D82E	probably benign	Het
Coq10b	T	C	1: 55,052,854		probably benign	Het
Cyb561	T	C	11: 105,940,109	N50S	probably benign	Het
Dctn4	G	T	18: 60,546,276	A223S	probably benign	Het
Dysf	A	G	6: 84,137,398	Y1223C	probably damaging	Het
Eed	C	T	7: 89,980,814		probably benign	Het
Eef1g	T	A	19: 8,977,374	V305E	probably benign	Het
Eif4ebp2	C	A	10: 61,434,993	A86S	probably benign	Het
Ermp1	T	C	19: 29,632,388		probably null	Het
Gm5065	A	T	7: 5,359,508	K46M	probably damaging	Het
Hid1	T	C	11: 115,358,995	Y198C	probably damaging	Het
Hoxd1	C	A	2: 74,763,472	A124E	probably benign	Het
Hyal5	G	A	6: 24,891,348	C387Y	probably damaging	Het
Il11	A	G	7: 4,776,000	S103P	probably damaging	Het
Lmtk3	A	C	7: 45,786,903	I128L	possibly damaging	Het
Lrrc4b	G	T	7: 44,444,892		probably benign	Het
Magel2	T	A	7: 62,378,368	I340N	possibly damaging	Het
Mfsd14a	A	T	3: 116,648,551	F71I	possibly damaging	Het
Mgarp	A	G	3: 51,389,066	S172P	probably benign	Het
Mug1	T	C	6: 121,870,652		probably null	Het
Naa15	G	T	3: 51,463,267	E651*	probably null	Het
Ndfip2	T	C	14: 105,292,241	V168A	probably benign	Het
Neb	C	A	2: 52,223,361		probably null	Het
Nfil3	A	G	13: 52,967,932	V312A	possibly damaging	Het
Nrap	T	C	19: 56,350,297	I953V	probably benign	Het
Ntrk1	T	A	3: 87,779,734	K706*	probably null	Het
Nuf2	A	T	1: 169,525,329	F36I	probably benign	Het
Olfr259	T	C	2: 87,107,517	Y290C	probably damaging	Het
Olfr573-ps1	T	A	7: 102,941,918	T220S	possibly damaging	Het
Pcdh8	T	G	14: 79,768,661	T821P	possibly damaging	Het
Ppl	C	T	16: 5,088,861	R1190H	probably damaging	Het
Ptch2	C	A	4: 117,105,027		probably null	Het
Ptdss1	A	G	13: 66,933,655	I50V	probably benign	Het
Pth2r	G	T	1: 65,351,563	W292L	probably damaging	Het
Ptprd	G	A	4: 75,982,644	T825M	probably damaging	Het
Ptprk	T	C	10: 28,573,389	Y987H	probably damaging	Het
Qser1	T	C	2: 104,776,234	E1470G	probably damaging	Het
Rab11fip3	T	C	17: 26,068,258	E307G	possibly damaging	Het
Rims2	A	G	15: 39,681,079	Y1484C	probably damaging	Het
Rock1	A	T	18: 10,097,651		probably null	Het
Snx11	T	A	11: 96,769,206	E219V	possibly damaging	Het
Sox21	C	A	14: 118,235,317	E107*	probably null	Het
Spink5	T	A	18: 43,999,821	H501Q	probably benign	Het
Stard5	C	T	7: 83,636,776	T103M	probably damaging	Het
Stfa2l1	A	T	16: 36,156,833		probably benign	Het
Sult1c1	A	C	17: 53,964,048	V185G	probably damaging	Het
Svs2	A	G	2: 164,237,580	S136P	possibly damaging	Het
Sytl3	T	A	17: 6,715,375		probably null	Het
Tc2n	C	T	12: 101,652,853	V349I	possibly damaging	Het
Tln1	A	G	4: 43,554,309	V271A	probably benign	Het
Tmem260	T	A	14: 48,509,062	S446R	probably benign	Het
Trim30a	T	C	7: 104,435,595	D136G	probably benign	Het
Uhrf1bp1l	C	T	10: 89,816,106	T1381I	probably benign	Het
Ulk4	A	T	9: 121,044,819	I1182N	possibly damaging	Het
Unc50	T	G	1: 37,437,296	I179S	possibly damaging	Het
Upb1	T	A	10: 75,412,833	Y57*	probably null	Het
Usp34	C	T	11: 23,446,614	T2349I		Het
Vmn1r71	A	G	7: 10,748,350	V137A	possibly damaging	Het
Vmn1r85	T	C	7: 13,084,771	I149V	probably benign	Het
Vmn2r118	A	G	17: 55,593,242	L554P	probably damaging	Het
Wdr4	C	G	17: 31,499,808		probably null	Het
Zbbx	A	T	3: 75,078,474	S424T	possibly damaging	Het
Zfp207	C	G	11: 80,391,900	P246A	probably damaging	Het
Zfp414	T	A	17: 33,629,988	Y65*	probably null	Het
Zfp600	T	A	4: 146,196,953	N730K	probably benign	Het
Zfp827	T	C	8: 79,186,350	L1073P	probably damaging	Het
Zfp986	A	G	4: 145,899,121	K117R	possibly damaging	Het
Zgrf1	T	A	3: 127,563,431	Y769N	probably damaging	Het
Zufsp	A	T	10: 33,919,319	I547N	unknown	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R8284:Slc15a1	UTSW	14	121489863	missense	probably benign	0.01
R8376:Slc15a1	UTSW	14	121480703	missense	probably benign
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
R8774:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8774-TAIL:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8933:Slc15a1	UTSW	14	121486679	missense	probably benign	0.00
R9157:Slc15a1	UTSW	14	121464977	missense	probably benign	0.08
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTTCTCCAGTCCACACAC -3'
(R):5'- CAGACTGGAGGGTAAACTGCTG -3'

Sequencing Primer
(F):5'- GTCCACACACTATTAGCATTGGGAG -3'
(R):5'- ACTGCTGGGAAGGAGACTCC -3'

Posted On

2019-12-20