Incidental Mutation 'R0091:Syne4'
ID60603
Institutional Source Beutler Lab
Gene Symbol Syne4
Ensembl Gene ENSMUSG00000019737
Gene Namespectrin repeat containing, nuclear envelope family member 4
Synonyms
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0091 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30314807-30319046 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30318919 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 362 (G362E)
Ref Sequence ENSEMBL: ENSMUSP00000055874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054594] [ENSMUST00000060834] [ENSMUST00000098585] [ENSMUST00000098586] [ENSMUST00000136887] [ENSMUST00000137550] [ENSMUST00000176304] [ENSMUST00000176504] [ENSMUST00000176789] [ENSMUST00000177078]
Predicted Effect probably damaging
Transcript: ENSMUST00000054594
AA Change: G362E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055874
Gene: ENSMUSG00000019737
AA Change: G362E

DomainStartEndE-ValueType
Blast:SPEC 96 198 2e-34 BLAST
low complexity region 222 234 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
KASH 335 388 2.85e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060834
SMART Domains Protein: ENSMUSP00000051515
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 23 224 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098585
SMART Domains Protein: ENSMUSP00000096184
Gene: ENSMUSG00000074210

DomainStartEndE-ValueType
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098586
SMART Domains Protein: ENSMUSP00000096185
Gene: ENSMUSG00000074211

DomainStartEndE-ValueType
Pfam:Complex1_LYR 9 63 2.1e-16 PFAM
Pfam:Complex1_LYR_1 9 65 5.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135882
Predicted Effect probably benign
Transcript: ENSMUST00000136887
SMART Domains Protein: ENSMUSP00000121953
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 3 210 2.1e-16 PFAM
Pfam:2OG-FeII_Oxy 82 213 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176253
Predicted Effect possibly damaging
Transcript: ENSMUST00000176304
AA Change: G279E

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135637
Gene: ENSMUSG00000019737
AA Change: G279E

DomainStartEndE-ValueType
Blast:SPEC 96 196 3e-34 BLAST
low complexity region 197 232 N/A INTRINSIC
KASH 252 305 2.85e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176504
SMART Domains Protein: ENSMUSP00000135844
Gene: ENSMUSG00000019737

DomainStartEndE-ValueType
Blast:SPEC 92 170 2e-33 BLAST
low complexity region 194 206 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176536
Predicted Effect probably benign
Transcript: ENSMUST00000176571
Predicted Effect probably benign
Transcript: ENSMUST00000176789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176984
Predicted Effect probably benign
Transcript: ENSMUST00000177078
SMART Domains Protein: ENSMUSP00000135895
Gene: ENSMUSG00000019737

DomainStartEndE-ValueType
Blast:SPEC 88 150 4e-24 BLAST
low complexity region 174 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177395
Meta Mutation Damage Score 0.3470 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nesprin family of genes, that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. In addition to the KASH domain, this protein also contains a coiled-coil and leucine zipper region, a spectrin repeat, and a kinesin-1 binding region. This protein localizes to the outer nuclear membrane, and is part of the linker of nucleoskeleton and cytoskeleton (LINC) complex in the nuclear envelope. LINC complexes are formed by SUN (Sad1, UNC-84)-KASH pairs, and are thought to mechanically couple nuclear components to the cytoskeleton. Mutations in this gene have been associated with progressive high-frequency hearing loss. The absence of this protein in mice also caused hearing loss, and changes in hair cell morphology in the ears. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss associated with outer hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Syne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Syne4 APN 7 30316563 splice site probably null
IGL02386:Syne4 APN 7 30316234 missense possibly damaging 0.91
R0089:Syne4 UTSW 7 30318919 missense probably damaging 0.99
R0448:Syne4 UTSW 7 30314920 start gained probably benign
R0555:Syne4 UTSW 7 30316744 missense probably damaging 0.99
R1205:Syne4 UTSW 7 30315336 missense probably damaging 0.96
R1862:Syne4 UTSW 7 30316883 missense probably benign 0.06
R1863:Syne4 UTSW 7 30316883 missense probably benign 0.06
R4776:Syne4 UTSW 7 30316833 splice site probably benign
R5325:Syne4 UTSW 7 30318976 missense probably damaging 1.00
R6145:Syne4 UTSW 7 30316563 splice site probably null
R6479:Syne4 UTSW 7 30316915 nonsense probably null
R7823:Syne4 UTSW 7 30318855 missense probably benign 0.09
Z1088:Syne4 UTSW 7 30316336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGCCTGATGCAATGCTGGAAG -3'
(R):5'- TGCCCTCAAGGCAAAGGAATACAAG -3'

Sequencing Primer
(F):5'- CAATGCTGGAAGTGGATCGC -3'
(R):5'- AGGAGCTGTCAGAACACAC -3'
Posted On2013-07-24