Incidental Mutation 'R0091:Prdx2'
Institutional Source Beutler Lab
Gene Symbol Prdx2
Ensembl Gene ENSMUSG00000005161
Gene Nameperoxiredoxin 2
SynonymsTR, Tdpx1, PrxII, Prx II-1, TPx, TDX1, thioredoxin dependent peroxide reductase 1, TSA, thiol specific antioxidant protein, Trx dependent peroxide reductase 1, thioredoxin reductase, thioredoxin peroxidase, protector protein, PRP
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R0091 (G1)
Quality Score120
Status Validated
Chromosomal Location84969587-84974834 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 84971701 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005292] [ENSMUST00000109733] [ENSMUST00000109734] [ENSMUST00000109736] [ENSMUST00000125893] [ENSMUST00000130902] [ENSMUST00000140561] [ENSMUST00000147812] [ENSMUST00000164807] [ENSMUST00000214133]
Predicted Effect probably benign
Transcript: ENSMUST00000005292
SMART Domains Protein: ENSMUSP00000005292
Gene: ENSMUSG00000005161

Pfam:Redoxin 7 157 3.9e-20 PFAM
Pfam:AhpC-TSA 8 141 5.6e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109733
SMART Domains Protein: ENSMUSP00000105355
Gene: ENSMUSG00000005161

Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109734
SMART Domains Protein: ENSMUSP00000105356
Gene: ENSMUSG00000005161

Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109736
SMART Domains Protein: ENSMUSP00000105358
Gene: ENSMUSG00000052926

Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125893
SMART Domains Protein: ENSMUSP00000122694
Gene: ENSMUSG00000005161

Pfam:Redoxin 7 147 1.4e-21 PFAM
Pfam:AhpC-TSA 8 141 2.3e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127215
Predicted Effect probably benign
Transcript: ENSMUST00000130902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138748
Predicted Effect probably benign
Transcript: ENSMUST00000140561
SMART Domains Protein: ENSMUSP00000118442
Gene: ENSMUSG00000052926

Pfam:RNase_HII 31 54 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143402
Predicted Effect probably benign
Transcript: ENSMUST00000147812
SMART Domains Protein: ENSMUSP00000120374
Gene: ENSMUSG00000052926

Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164807
SMART Domains Protein: ENSMUSP00000126451
Gene: ENSMUSG00000005161

Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209372
Predicted Effect probably benign
Transcript: ENSMUST00000214133
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein plays an antioxidant protective role in cells, and it may contribute to the antiviral activity of CD8(+) T-cells. The crystal structure of this protein has been resolved to 2.7 angstroms. This protein prevents hemolytic anemia from oxidative stress by stabilizing hemoglobin, thus making this gene a therapeutic target for patients with hemolytic anemia. This protein may have a proliferative effect and play a role in cancer development or progression. Related pseudogenes have been identified on chromosomes 5, 6, 10 and 13. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous null mice have hemolytic anemia and exhibit enlarged spleens due to congestion of the red pulp. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Prdx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Prdx2 APN 8 84974052 missense probably benign
IGL03126:Prdx2 APN 8 84971569 missense probably damaging 1.00
R0109:Prdx2 UTSW 8 84970251 missense probably benign 0.08
R0109:Prdx2 UTSW 8 84970251 missense probably benign 0.08
R5288:Prdx2 UTSW 8 84971673 nonsense probably null
R7788:Prdx2 UTSW 8 84971674 missense probably benign 0.02
R8367:Prdx2 UTSW 8 84971615 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gagagagcatcagattcccc -3'
Posted On2013-07-24