Incidental Mutation 'R0091:Tnfrsf21'
ID60605
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0091 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43038213 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 239 (H239Y)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
R8495:Tnfrsf21 UTSW 17 43038237 missense probably benign
R8865:Tnfrsf21 UTSW 17 43085481 missense probably damaging 1.00
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAAAGCTCACACGGACTGTCTGG -3'
(R):5'- GCTCCATCTACACACGATTAGCTCC -3'

Sequencing Primer
(F):5'- GGACTGTCTGGGTCAGAAC -3'
(R):5'- acaactaaaatcactcaactcactc -3'
Posted On2013-07-24