Incidental Mutation 'R7837:Sept7'
ID606055
Institutional Source Beutler Lab
Gene Symbol Sept7
Ensembl Gene ENSMUSG00000001833
Gene Nameseptin 7
SynonymsCdc10
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7837 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location25252439-25308571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25288235 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 143 (N143K)
Ref Sequence ENSEMBL: ENSMUSP00000110927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115272] [ENSMUST00000165594]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115272
AA Change: N143K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110927
Gene: ENSMUSG00000001833
AA Change: N143K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.7e-126 PFAM
Pfam:MMR_HSR1 52 252 2.5e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165594
AA Change: N143K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127641
Gene: ENSMUSG00000001833
AA Change: N143K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.6e-126 PFAM
Pfam:MMR_HSR1 52 197 4.9e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons exhibit reduced axon and dendrite length and complexity. Mice homozygous for a knock-out allele die prior to E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik A T 13: 34,944,376 Q192L possibly damaging Het
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tarbp1 T C 8: 126,474,561 S169G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in Sept7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02692:Sept7 APN 9 25296490 splice site probably benign
R0331:Sept7 UTSW 9 25306256 missense probably benign 0.00
R1590:Sept7 UTSW 9 25277604 missense probably damaging 0.99
R2040:Sept7 UTSW 9 25288236 missense possibly damaging 0.79
R4935:Sept7 UTSW 9 25306172 missense probably benign 0.03
R5246:Sept7 UTSW 9 25299536 missense probably damaging 1.00
R5426:Sept7 UTSW 9 25286690 missense possibly damaging 0.92
R5629:Sept7 UTSW 9 25288293 missense probably damaging 1.00
R5994:Sept7 UTSW 9 25288198 missense possibly damaging 0.52
R6177:Sept7 UTSW 9 25293804 critical splice donor site probably null
R6246:Sept7 UTSW 9 25307521 missense probably benign 0.00
R6735:Sept7 UTSW 9 25303752 missense possibly damaging 0.94
R7561:Sept7 UTSW 9 25297855 missense possibly damaging 0.77
R8442:Sept7 UTSW 9 25252642 missense unknown
X0066:Sept7 UTSW 9 25306140 missense possibly damaging 0.88
Z1176:Sept7 UTSW 9 25252556 start gained probably benign
Z1177:Sept7 UTSW 9 25301423 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTACCTACTTTTGAGTCAGTGTGC -3'
(R):5'- AAATGACCTAGTTCCGTGTACTCC -3'

Sequencing Primer
(F):5'- TGAGTCAGTGTGCAGAAAAATTTG -3'
(R):5'- AGTTCCGTGTACTCCACAGAC -3'
Posted On2019-12-20