Incidental Mutation 'R7837:4933417A18Rik'
ID606063
Institutional Source Beutler Lab
Gene Symbol 4933417A18Rik
Ensembl Gene ENSMUSG00000021415
Gene NameRIKEN cDNA 4933417A18 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7837 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location34924409-34955875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34944376 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 192 (Q192L)
Ref Sequence ENSEMBL: ENSMUSP00000125324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021853] [ENSMUST00000160279] [ENSMUST00000160905] [ENSMUST00000164155]
Predicted Effect probably benign
Transcript: ENSMUST00000021853
SMART Domains Protein: ENSMUSP00000021853
Gene: ENSMUSG00000021416

DomainStartEndE-ValueType
Pfam:ACBP 1 42 3.4e-10 PFAM
Pfam:ECH_1 67 314 4.7e-41 PFAM
Pfam:ECH_2 72 316 1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160279
AA Change: Q192L

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125324
Gene: ENSMUSG00000021415
AA Change: Q192L

DomainStartEndE-ValueType
Pfam:DUF4523 34 199 1.1e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160905
AA Change: Q192L

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125206
Gene: ENSMUSG00000021415
AA Change: Q192L

DomainStartEndE-ValueType
Pfam:DUF4523 34 199 9.5e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164155
SMART Domains Protein: ENSMUSP00000132701
Gene: ENSMUSG00000021416

DomainStartEndE-ValueType
Pfam:ACBP 1 45 4.4e-10 PFAM
Pfam:ECH 65 260 5.4e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,617,977 S108P probably damaging Het
Acox3 A G 5: 35,611,486 probably null Het
Adam22 T A 5: 8,149,284 probably null Het
Adgrb3 T C 1: 25,128,834 Y1007C probably damaging Het
Akap2 A G 4: 57,855,262 D197G probably damaging Het
Anapc4 T A 5: 52,859,208 probably null Het
Aoc1 T A 6: 48,905,650 Y153* probably null Het
Armc1 A T 3: 19,144,469 I109N probably benign Het
Bcl2 A C 1: 106,543,356 F207V possibly damaging Het
Btd C A 14: 31,666,827 S168R possibly damaging Het
Cage1 A T 13: 38,022,405 M488K not run Het
Cenpj T C 14: 56,558,728 N224S probably benign Het
Cln6 T C 9: 62,849,048 V81A Het
Crispld1 T A 1: 17,728,730 V25E probably benign Het
Dnah12 A G 14: 26,796,219 T1808A probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Dtx3l T A 16: 35,931,526 N675I probably damaging Het
Dusp28 A G 1: 92,907,683 E163G probably benign Het
Ecd A T 14: 20,333,332 F346L probably damaging Het
F5 G A 1: 164,186,794 V545M probably damaging Het
Gm19410 A T 8: 35,808,980 Y1597F possibly damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gria2 A T 3: 80,710,788 N313K probably benign Het
Igkv13-84 C T 6: 68,939,809 S30F possibly damaging Het
Kcnh6 C A 11: 106,033,810 H867N probably benign Het
Krt82 T C 15: 101,548,357 Q196R possibly damaging Het
Mbd4 T C 6: 115,849,539 N164D probably benign Het
Mrgpra1 A T 7: 47,335,328 M201K possibly damaging Het
Msh6 G A 17: 87,984,666 G283E probably damaging Het
Msr1 C T 8: 39,581,832 C426Y probably damaging Het
Muc5ac A G 7: 141,815,963 H3149R possibly damaging Het
Nr1i2 T C 16: 38,253,784 M156V probably benign Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1189 A T 2: 88,592,379 I192F possibly damaging Het
Olfr532 T C 7: 140,419,321 I151V probably benign Het
Olfr610 A T 7: 103,506,845 C34S possibly damaging Het
Olfr725 T A 14: 50,034,576 T276S probably damaging Het
Pcnx4 C A 12: 72,556,118 L385M probably damaging Het
Plscr4 T A 9: 92,484,923 C197S probably damaging Het
Rin3 A G 12: 102,368,765 T312A unknown Het
Sept7 T A 9: 25,288,235 N143K possibly damaging Het
Sgk2 A G 2: 163,003,296 K208E probably damaging Het
Slc4a5 A T 6: 83,261,557 T236S probably benign Het
Sptbn1 A G 11: 30,138,832 L810P probably damaging Het
Stard9 A G 2: 120,703,665 S3468G probably benign Het
Tarbp1 T C 8: 126,474,561 S169G probably benign Het
Tmem2 T A 19: 21,798,021 D209E probably benign Het
Tmem246 A T 4: 49,586,262 M302K probably damaging Het
Tssk2 T C 16: 17,898,751 V6A possibly damaging Het
Ttll4 A T 1: 74,681,757 probably null Het
Ubr4 C T 4: 139,393,151 R296* probably null Het
Wscd2 G T 5: 113,572,333 C306F probably damaging Het
Zbtb43 C T 2: 33,453,969 G378R probably damaging Het
Zdhhc12 A T 2: 30,091,697 V165E probably damaging Het
Zfp59 GAAA GAAAAA 7: 27,854,917 probably null Het
Zfp943 A T 17: 21,992,365 Y144F probably benign Het
Zkscan8 T A 13: 21,520,428 N447I possibly damaging Het
Other mutations in 4933417A18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:4933417A18Rik APN 13 34924533 splice site probably null
IGL02726:4933417A18Rik APN 13 34952960 intron probably benign
IGL03241:4933417A18Rik APN 13 34944330 missense probably damaging 0.98
R0324:4933417A18Rik UTSW 13 34924613 missense probably benign
R0394:4933417A18Rik UTSW 13 34932653 splice site probably benign
R0409:4933417A18Rik UTSW 13 34924549 missense probably benign 0.08
R1639:4933417A18Rik UTSW 13 34944250 missense possibly damaging 0.93
R1861:4933417A18Rik UTSW 13 34932507 missense possibly damaging 0.80
R2054:4933417A18Rik UTSW 13 34924591 missense probably damaging 0.99
R4625:4933417A18Rik UTSW 13 34932465 missense probably damaging 1.00
R4932:4933417A18Rik UTSW 13 34932630 missense possibly damaging 0.95
R5875:4933417A18Rik UTSW 13 34932446 missense probably damaging 0.99
R8836:4933417A18Rik UTSW 13 34932543 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGAGGACCTCAAATCAGTTATCC -3'
(R):5'- AGACTGAGCAGGTTGTATTTATGC -3'

Sequencing Primer
(F):5'- GTTATCCAAAGACTGTCAGCACTTGG -3'
(R):5'- TTTATGCATTTACACACACACAGAC -3'
Posted On2019-12-20