Incidental Mutation 'R7838:Mcoln3'
ID 606088
Institutional Source Beutler Lab
Gene Symbol Mcoln3
Ensembl Gene ENSMUSG00000036853
Gene Name mucolipin 3
Synonyms Va, varitint-waddler, TRPML3, 6720490O21Rik
MMRRC Submission 045892-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R7838 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 145823205-145847561 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 145845230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Cysteine at position 475 (W475C)
Ref Sequence ENSEMBL: ENSMUSP00000038801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039450]
AlphaFold Q8R4F0
Predicted Effect probably damaging
Transcript: ENSMUST00000039450
AA Change: W475C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038801
Gene: ENSMUSG00000036853
AA Change: W475C

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Pfam:PKD_channel 360 508 3.5e-15 PFAM
Meta Mutation Damage Score 0.8537 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Heterozygotes show normal/diluted/white hair patches, circling, hyperactivity, deafness, and reduced fertility. Homozygotes are white with small patches of color and show severe behavioral abnormalities, poor postnatal viability and are nearly infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G A 10: 87,042,061 (GRCm39) probably null Het
4930522H14Rik G A 4: 109,362,776 (GRCm39) A181V probably damaging Het
Alk A T 17: 72,274,549 (GRCm39) H587Q possibly damaging Het
Ascc3 A G 10: 50,604,393 (GRCm39) Y1371C probably benign Het
Asxl1 T C 2: 153,238,733 (GRCm39) F354S probably damaging Het
Cachd1 A T 4: 100,824,211 (GRCm39) I551F possibly damaging Het
Cacna1e T C 1: 154,347,149 (GRCm39) E1068G probably benign Het
Cdc27 A T 11: 104,403,830 (GRCm39) M644K probably damaging Het
Chl1 T C 6: 103,668,635 (GRCm39) V456A probably benign Het
Ctxn1 A G 8: 4,308,461 (GRCm39) Y57H probably damaging Het
Cyp2c54 A G 19: 40,058,688 (GRCm39) I248T probably benign Het
Dchs2 A G 3: 83,211,834 (GRCm39) T1878A probably benign Het
Ddi2 A G 4: 141,412,561 (GRCm39) V117A probably benign Het
Dennd5a G T 7: 109,533,196 (GRCm39) F191L probably benign Het
Dnm3 C T 1: 161,819,619 (GRCm39) R851H possibly damaging Het
Eif3l G A 15: 78,973,799 (GRCm39) D405N possibly damaging Het
Espn T A 4: 152,215,738 (GRCm39) D507V possibly damaging Het
Fam83f A T 15: 80,576,704 (GRCm39) S452C possibly damaging Het
Fbxo22 A C 9: 55,125,651 (GRCm39) E171D probably damaging Het
Fgl2 T C 5: 21,577,752 (GRCm39) V13A probably benign Het
Fsip2 A G 2: 82,807,044 (GRCm39) H1121R probably benign Het
G0s2 A T 1: 192,955,081 (GRCm39) M1K probably null Het
Gnptab G A 10: 88,276,254 (GRCm39) probably null Het
Grm1 G A 10: 10,956,096 (GRCm39) P63S probably benign Het
Grsf1 G A 5: 88,823,523 (GRCm39) probably benign Het
Hcfc1r1 G A 17: 23,892,985 (GRCm39) G10D probably damaging Het
Hdac1-ps A C 17: 78,799,447 (GRCm39) E146A probably damaging Het
Igsf11 T C 16: 38,827,565 (GRCm39) V41A possibly damaging Het
Il17a C A 1: 20,802,351 (GRCm39) A20E probably benign Het
Kcnv2 A G 19: 27,300,332 (GRCm39) Y61C probably damaging Het
Kmt2c A G 5: 25,499,697 (GRCm39) M481T possibly damaging Het
Krt40 A T 11: 99,430,961 (GRCm39) C263S possibly damaging Het
Larp1 T C 11: 57,938,540 (GRCm39) V441A possibly damaging Het
Lrwd1 T C 5: 136,160,983 (GRCm39) E300G probably damaging Het
Mdga1 A G 17: 30,058,796 (GRCm39) I30T probably benign Het
Mmd T A 11: 90,158,433 (GRCm39) V181D probably benign Het
Muc4 T A 16: 32,752,558 (GRCm38) L812* probably null Het
Mycbp2 T C 14: 103,414,729 (GRCm39) D2561G probably benign Het
Myh11 T A 16: 14,027,481 (GRCm39) E1251V Het
Myl12a G T 17: 71,303,166 (GRCm39) N95K probably benign Het
Myo1h A G 5: 114,466,872 (GRCm39) probably null Het
Myrf G A 19: 10,196,983 (GRCm39) P266S possibly damaging Het
Ncf1 A G 5: 134,250,949 (GRCm39) V330A possibly damaging Het
Nfasc T C 1: 132,533,287 (GRCm39) D638G probably damaging Het
Nkapl T C 13: 21,651,437 (GRCm39) K392R possibly damaging Het
Or2y3 A G 17: 38,393,293 (GRCm39) V192A probably benign Het
Or6a2 A T 7: 106,600,514 (GRCm39) C184* probably null Het
Or8b50 A G 9: 38,517,708 (GRCm39) probably benign Het
Pelo T A 13: 115,226,184 (GRCm39) N91I probably damaging Het
Ptk2b T C 14: 66,395,850 (GRCm39) N836D probably benign Het
Pwp2 A T 10: 78,018,778 (GRCm39) probably null Het
Slc44a1 G A 4: 53,517,657 (GRCm39) V127I probably benign Het
Snx13 A G 12: 35,155,174 (GRCm39) T413A probably benign Het
Spaca7 C T 8: 12,635,696 (GRCm39) P71S probably damaging Het
Spef2 A T 15: 9,609,637 (GRCm39) M1296K possibly damaging Het
Suco G A 1: 161,656,890 (GRCm39) A978V probably benign Het
Tcerg1 A G 18: 42,670,002 (GRCm39) E494G probably benign Het
Tenm2 A G 11: 35,997,626 (GRCm39) V821A probably benign Het
Tg T A 15: 66,565,112 (GRCm39) D1151E probably benign Het
Trp53bp2 A G 1: 182,283,384 (GRCm39) E1040G probably damaging Het
Ubap2 A T 4: 41,233,655 (GRCm39) N79K probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Yars2 T G 16: 16,122,385 (GRCm39) probably null Het
Ylpm1 A G 12: 85,095,640 (GRCm39) I1847V possibly damaging Het
Other mutations in Mcoln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mcoln3 APN 3 145,839,683 (GRCm39) missense probably damaging 1.00
IGL01106:Mcoln3 APN 3 145,843,019 (GRCm39) missense probably benign 0.01
IGL01712:Mcoln3 APN 3 145,834,019 (GRCm39) unclassified probably benign
IGL02115:Mcoln3 APN 3 145,843,056 (GRCm39) missense probably damaging 0.99
IGL02116:Mcoln3 APN 3 145,839,664 (GRCm39) missense probably benign 0.29
P4717OSA:Mcoln3 UTSW 3 145,830,504 (GRCm39) missense probably damaging 0.99
R0463:Mcoln3 UTSW 3 145,846,331 (GRCm39) nonsense probably null
R1981:Mcoln3 UTSW 3 145,846,345 (GRCm39) nonsense probably null
R2056:Mcoln3 UTSW 3 145,833,979 (GRCm39) missense probably benign 0.01
R3000:Mcoln3 UTSW 3 145,839,662 (GRCm39) missense possibly damaging 0.62
R4366:Mcoln3 UTSW 3 145,846,247 (GRCm39) missense possibly damaging 0.76
R4667:Mcoln3 UTSW 3 145,836,959 (GRCm39) missense probably benign 0.01
R4950:Mcoln3 UTSW 3 145,845,274 (GRCm39) missense probably damaging 0.96
R5457:Mcoln3 UTSW 3 145,833,877 (GRCm39) missense probably benign 0.00
R6302:Mcoln3 UTSW 3 145,830,527 (GRCm39) missense probably benign 0.00
R6353:Mcoln3 UTSW 3 145,836,909 (GRCm39) missense probably damaging 0.99
R6632:Mcoln3 UTSW 3 145,833,942 (GRCm39) missense probably benign
R6915:Mcoln3 UTSW 3 145,843,011 (GRCm39) critical splice acceptor site probably null
R7790:Mcoln3 UTSW 3 145,845,247 (GRCm39) missense probably damaging 1.00
R7861:Mcoln3 UTSW 3 145,830,546 (GRCm39) missense possibly damaging 0.95
R8348:Mcoln3 UTSW 3 145,836,974 (GRCm39) missense probably damaging 1.00
R8509:Mcoln3 UTSW 3 145,830,647 (GRCm39) missense probably benign 0.00
R8708:Mcoln3 UTSW 3 145,846,276 (GRCm39) nonsense probably null
R8838:Mcoln3 UTSW 3 145,845,126 (GRCm39) missense probably damaging 1.00
R8861:Mcoln3 UTSW 3 145,845,159 (GRCm39) missense probably damaging 1.00
R8981:Mcoln3 UTSW 3 145,827,554 (GRCm39) missense probably benign
Z1176:Mcoln3 UTSW 3 145,846,221 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGTTGGGAAAGGAGCACC -3'
(R):5'- TACCCCATCAGTGTCCTCTGAG -3'

Sequencing Primer
(F):5'- ATACCAGGTCAGGATGCTGTC -3'
(R):5'- ATCAGTGTCCTCTGAGTACCAAG -3'
Posted On 2019-12-20