Incidental Mutation 'R0092:Adam2'
ID 60610
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Name a disintegrin and metallopeptidase domain 2
Synonyms fertilin beta, Ph30-beta, Ftnb
MMRRC Submission 038379-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0092 (G1)
Quality Score 164
Status Validated
Chromosome 14
Chromosomal Location 66264778-66315182 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 66291336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 314 (A314V)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
AlphaFold Q60718
Predicted Effect probably damaging
Transcript: ENSMUST00000022618
AA Change: A314V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: A314V

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225667
Meta Mutation Damage Score 0.6536 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,662,762 (GRCm39) S535T probably benign Het
Acad11 A T 9: 103,967,540 (GRCm39) probably benign Het
Acadm A T 3: 153,647,512 (GRCm39) probably benign Het
Acot12 T A 13: 91,889,684 (GRCm39) M12K probably damaging Het
Actr2 A T 11: 20,044,308 (GRCm39) N99K probably benign Het
Agl C T 3: 116,587,453 (GRCm39) R34Q probably damaging Het
Agrn C T 4: 156,263,410 (GRCm39) R338H probably damaging Het
AI661453 A G 17: 47,778,440 (GRCm39) probably benign Het
Alpk3 A G 7: 80,742,301 (GRCm39) D706G probably benign Het
Apbb1 T C 7: 105,208,361 (GRCm39) E648G probably damaging Het
Astn2 C A 4: 66,322,219 (GRCm39) A127S unknown Het
Asxl2 T C 12: 3,546,313 (GRCm39) S366P probably benign Het
Bdh1 A T 16: 31,266,380 (GRCm39) K92* probably null Het
Bltp1 A G 3: 37,082,308 (GRCm39) D3790G probably benign Het
Cacna1g C T 11: 94,348,090 (GRCm39) S666N probably damaging Het
Ces2b A G 8: 105,563,144 (GRCm39) T361A possibly damaging Het
Col6a4 T A 9: 105,890,513 (GRCm39) E1927V probably benign Het
Ctnnb1 T G 9: 120,781,929 (GRCm39) I314S possibly damaging Het
Cyp2c66 T C 19: 39,172,224 (GRCm39) probably benign Het
Dennd4c T A 4: 86,699,844 (GRCm39) F232I probably damaging Het
Dennd5a T C 7: 109,499,013 (GRCm39) N950S possibly damaging Het
Dhx30 T C 9: 109,914,078 (GRCm39) N14S possibly damaging Het
Dip2b T A 15: 100,100,146 (GRCm39) V1004D probably damaging Het
Dnah1 A C 14: 30,993,566 (GRCm39) S2872A probably benign Het
Dnajc10 T C 2: 80,156,026 (GRCm39) V233A probably damaging Het
E230025N22Rik A G 18: 36,822,277 (GRCm39) L162P probably damaging Het
Elmod3 T C 6: 72,543,792 (GRCm39) D333G probably benign Het
Epb41l3 T A 17: 69,593,745 (GRCm39) M846K probably damaging Het
Frem2 A G 3: 53,497,217 (GRCm39) Y1766H probably benign Het
Fxr2 T C 11: 69,532,972 (GRCm39) probably benign Het
Gmpr2 A G 14: 55,915,402 (GRCm39) R258G probably benign Het
Helb T C 10: 119,925,713 (GRCm39) Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,001,899 (GRCm39) probably null Het
Hipk2 T C 6: 38,720,164 (GRCm39) D482G probably damaging Het
Itgb4 G T 11: 115,869,950 (GRCm39) R44L probably damaging Het
Itih1 T C 14: 30,662,820 (GRCm39) probably benign Het
Kit T A 5: 75,808,414 (GRCm39) S719R possibly damaging Het
Krt13 G A 11: 100,012,258 (GRCm39) Q22* probably null Het
L3mbtl4 A C 17: 68,732,698 (GRCm39) R59S probably benign Het
Lpp A G 16: 24,580,352 (GRCm39) S23G probably benign Het
Magi3 G A 3: 103,958,280 (GRCm39) Q602* probably null Het
Man2a1 A G 17: 64,966,079 (GRCm39) probably benign Het
Muc5ac A G 7: 141,372,367 (GRCm39) E2667G possibly damaging Het
Myef2l G A 3: 10,153,633 (GRCm39) C134Y possibly damaging Het
Myo15b C G 11: 115,753,812 (GRCm39) S842C possibly damaging Het
Naf1 T A 8: 67,341,760 (GRCm39) S462T probably benign Het
Necab3 T C 2: 154,400,659 (GRCm39) D34G possibly damaging Het
Nisch C A 14: 30,913,410 (GRCm39) probably benign Het
Nlrc5 T C 8: 95,216,222 (GRCm39) probably benign Het
Nmt1 T C 11: 102,937,319 (GRCm39) F119L probably damaging Het
Nod1 T G 6: 54,921,526 (GRCm39) D264A probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Nt5e T A 9: 88,252,338 (GRCm39) F567I probably benign Het
Obscn A T 11: 58,942,073 (GRCm39) M4434K possibly damaging Het
Opa1 A T 16: 29,444,412 (GRCm39) D866V probably damaging Het
Or10a3m T C 7: 108,313,031 (GRCm39) V145A probably benign Het
Or10al3 T G 17: 38,011,696 (GRCm39) L45R probably damaging Het
Or10p1 A G 10: 129,444,090 (GRCm39) S87P probably damaging Het
Or1j21 A G 2: 36,683,508 (GRCm39) T87A probably benign Het
Or51ai2 T C 7: 103,586,934 (GRCm39) S116P probably damaging Het
Otop1 T A 5: 38,457,174 (GRCm39) V311E probably damaging Het
Pcsk2 A G 2: 143,642,944 (GRCm39) D407G probably damaging Het
Pdcd1 A G 1: 93,980,149 (GRCm39) W23R possibly damaging Het
Pigp A G 16: 94,166,321 (GRCm39) V129A probably damaging Het
Pik3r5 A G 11: 68,383,629 (GRCm39) R483G probably benign Het
Pink1 A G 4: 138,047,309 (GRCm39) V225A probably benign Het
Plcl1 C G 1: 55,735,924 (GRCm39) Q422E probably damaging Het
Plec T C 15: 76,067,943 (GRCm39) E1222G probably benign Het
Polr1a T C 6: 71,944,439 (GRCm39) probably benign Het
Prokr2 C T 2: 132,215,517 (GRCm39) V154M probably damaging Het
Rasgrp4 A G 7: 28,844,557 (GRCm39) R280G possibly damaging Het
Rmnd5b T C 11: 51,520,419 (GRCm39) E8G possibly damaging Het
Sbf2 T A 7: 109,920,013 (GRCm39) probably benign Het
Sec23b A G 2: 144,408,830 (GRCm39) M172V probably benign Het
Setx T C 2: 29,036,305 (GRCm39) V930A probably benign Het
Sft2d2 G A 1: 165,006,829 (GRCm39) A159V possibly damaging Het
Sh3gl1 G T 17: 56,325,088 (GRCm39) R250S probably benign Het
Skor1 C A 9: 63,053,277 (GRCm39) D231Y probably damaging Het
Slc24a1 T G 9: 64,856,034 (GRCm39) E291A unknown Het
Slc28a2b G T 2: 122,348,078 (GRCm39) probably benign Het
Smc1b A T 15: 84,951,925 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,644,844 (GRCm39) N177K possibly damaging Het
Tdp1 T A 12: 99,921,248 (GRCm39) Y595N probably damaging Het
Tle5 G A 10: 81,397,054 (GRCm39) G10D possibly damaging Het
Tmem108 T C 9: 103,366,504 (GRCm39) K496E possibly damaging Het
Tmprss7 T C 16: 45,487,959 (GRCm39) D490G probably damaging Het
Tnrc6b A T 15: 80,802,729 (GRCm39) N1511Y probably damaging Het
Top2b G A 14: 16,409,263 (GRCm38) R802Q probably damaging Het
Trip10 A T 17: 57,557,798 (GRCm39) K27N possibly damaging Het
Txlnb A G 10: 17,718,503 (GRCm39) N445D possibly damaging Het
Txnrd1 T A 10: 82,715,636 (GRCm39) I159N probably damaging Het
Ulk1 C A 5: 110,944,193 (GRCm39) A164S probably null Het
Vmn2r83 T C 10: 79,327,798 (GRCm39) V802A probably damaging Het
Zbtb4 A G 11: 69,670,177 (GRCm39) I967V probably benign Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66,311,498 (GRCm39) critical splice donor site probably null
IGL00980:Adam2 APN 14 66,293,977 (GRCm39) nonsense probably null
IGL01404:Adam2 APN 14 66,314,659 (GRCm39) critical splice donor site probably null
IGL01901:Adam2 APN 14 66,272,678 (GRCm39) splice site probably benign
IGL02687:Adam2 APN 14 66,306,639 (GRCm39) missense probably damaging 1.00
IGL02692:Adam2 APN 14 66,311,536 (GRCm39) missense probably damaging 1.00
IGL02695:Adam2 APN 14 66,287,929 (GRCm39) missense probably benign 0.01
IGL02798:Adam2 APN 14 66,277,724 (GRCm39) missense probably damaging 1.00
IGL03217:Adam2 APN 14 66,272,262 (GRCm39) missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66,291,280 (GRCm39) missense probably benign 0.03
aldrin UTSW 14 66,295,086 (GRCm39) missense probably damaging 1.00
armstrong UTSW 14 66,275,006 (GRCm39) missense possibly damaging 0.95
sacher UTSW 14 66,306,007 (GRCm39) missense probably damaging 1.00
zuker UTSW 14 66,297,361 (GRCm39) missense probably benign 0.14
R0281:Adam2 UTSW 14 66,275,055 (GRCm39) missense probably benign 0.20
R0636:Adam2 UTSW 14 66,272,265 (GRCm39) missense probably benign 0.03
R0690:Adam2 UTSW 14 66,295,095 (GRCm39) missense probably damaging 1.00
R0727:Adam2 UTSW 14 66,267,180 (GRCm39) missense probably damaging 1.00
R1477:Adam2 UTSW 14 66,315,149 (GRCm39) missense possibly damaging 0.96
R1634:Adam2 UTSW 14 66,295,180 (GRCm39) missense probably damaging 1.00
R1652:Adam2 UTSW 14 66,314,700 (GRCm39) missense probably benign 0.41
R1717:Adam2 UTSW 14 66,306,007 (GRCm39) missense probably damaging 1.00
R1868:Adam2 UTSW 14 66,315,107 (GRCm39) missense probably damaging 0.99
R1915:Adam2 UTSW 14 66,275,006 (GRCm39) missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66,297,361 (GRCm39) missense probably benign 0.14
R3953:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3954:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3955:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3956:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3957:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R4091:Adam2 UTSW 14 66,267,172 (GRCm39) missense probably damaging 0.97
R5673:Adam2 UTSW 14 66,306,681 (GRCm39) missense probably benign 0.03
R5761:Adam2 UTSW 14 66,283,595 (GRCm39) missense probably damaging 1.00
R6187:Adam2 UTSW 14 66,306,068 (GRCm39) missense possibly damaging 0.89
R6499:Adam2 UTSW 14 66,296,239 (GRCm39) missense probably damaging 1.00
R6730:Adam2 UTSW 14 66,275,025 (GRCm39) missense possibly damaging 0.83
R6829:Adam2 UTSW 14 66,265,446 (GRCm39) critical splice donor site probably null
R7023:Adam2 UTSW 14 66,280,505 (GRCm39) missense probably benign 0.22
R7168:Adam2 UTSW 14 66,296,241 (GRCm39) missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66,291,361 (GRCm39) nonsense probably null
R7293:Adam2 UTSW 14 66,272,634 (GRCm39) missense probably benign 0.29
R7604:Adam2 UTSW 14 66,293,990 (GRCm39) missense probably benign 0.17
R7765:Adam2 UTSW 14 66,297,345 (GRCm39) missense probably damaging 1.00
R8380:Adam2 UTSW 14 66,275,006 (GRCm39) missense probably benign 0.01
R8532:Adam2 UTSW 14 66,293,970 (GRCm39) missense probably damaging 1.00
R8728:Adam2 UTSW 14 66,295,086 (GRCm39) missense probably damaging 1.00
R8744:Adam2 UTSW 14 66,272,165 (GRCm39) critical splice donor site probably null
R9282:Adam2 UTSW 14 66,267,238 (GRCm39) missense probably benign 0.00
R9307:Adam2 UTSW 14 66,287,921 (GRCm39) missense probably damaging 1.00
R9560:Adam2 UTSW 14 66,275,102 (GRCm39) missense probably benign 0.12
R9574:Adam2 UTSW 14 66,275,071 (GRCm39) missense probably benign 0.10
R9608:Adam2 UTSW 14 66,291,279 (GRCm39) missense probably null 0.05
X0061:Adam2 UTSW 14 66,291,354 (GRCm39) missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66,293,970 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGCTTTGGCTGGCAGA -3'
(R):5'- GCATGTTTTCACTCAACTGTGTGGC -3'

Sequencing Primer
(F):5'- tgttttattgtttttgtttcccctc -3'
(R):5'- CAAGCACATTTGTGGTCTGG -3'
Posted On 2013-07-24