Incidental Mutation 'R7838:Olfr914'
ID606105
Institutional Source Beutler Lab
Gene Symbol Olfr914
Ensembl Gene ENSMUSG00000047050
Gene Nameolfactory receptor 914
SynonymsMOR165-7, GA_x6K02T2PVTD-32308823-32309773
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7838 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38605102-38610978 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 38606412 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057755] [ENSMUST00000217057]
Predicted Effect probably benign
Transcript: ENSMUST00000057755
SMART Domains Protein: ENSMUSP00000053405
Gene: ENSMUSG00000047050

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 1.1e-48 PFAM
Pfam:7tm_1 41 290 5.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217057
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G A 10: 87,206,199 probably null Het
4930522H14Rik G A 4: 109,505,579 A181V probably damaging Het
Alk A T 17: 71,967,554 H587Q possibly damaging Het
Ascc3 A G 10: 50,728,297 Y1371C probably benign Het
Asxl1 T C 2: 153,396,813 F354S probably damaging Het
Cachd1 A T 4: 100,967,014 I551F possibly damaging Het
Cacna1e T C 1: 154,471,403 E1068G probably benign Het
Cdc27 A T 11: 104,513,004 M644K probably damaging Het
Chl1 T C 6: 103,691,674 V456A probably benign Het
Ctxn1 A G 8: 4,258,461 Y57H probably damaging Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
Dchs2 A G 3: 83,304,527 T1878A probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Dennd5a G T 7: 109,933,989 F191L probably benign Het
Dnm3 C T 1: 161,992,050 R851H possibly damaging Het
Eif3l G A 15: 79,089,599 D405N possibly damaging Het
Espn T A 4: 152,131,281 D507V possibly damaging Het
Fam83f A T 15: 80,692,503 S452C possibly damaging Het
Fbxo22 A C 9: 55,218,367 E171D probably damaging Het
Fgl2 T C 5: 21,372,754 V13A probably benign Het
Fsip2 A G 2: 82,976,700 H1121R probably benign Het
G0s2 A T 1: 193,272,773 M1K probably null Het
Gm10093 A C 17: 78,492,018 E146A probably damaging Het
Gnptab G A 10: 88,440,392 probably null Het
Grm1 G A 10: 11,080,352 P63S probably benign Het
Grsf1 G A 5: 88,675,664 probably benign Het
Hcfc1r1 G A 17: 23,674,011 G10D probably damaging Het
Igsf11 T C 16: 39,007,203 V41A possibly damaging Het
Il17a C A 1: 20,732,127 A20E probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kmt2c A G 5: 25,294,699 M481T possibly damaging Het
Krt40 A T 11: 99,540,135 C263S possibly damaging Het
Larp1 T C 11: 58,047,714 V441A possibly damaging Het
Lrwd1 T C 5: 136,132,129 E300G probably damaging Het
Mcoln3 G T 3: 146,139,475 W475C probably damaging Het
Mdga1 A G 17: 29,839,822 I30T probably benign Het
Mmd T A 11: 90,267,607 V181D probably benign Het
Muc4 T A 16: 32,752,558 L812* probably null Het
Mycbp2 T C 14: 103,177,293 D2561G probably benign Het
Myh11 T A 16: 14,209,617 E1251V Het
Myl12a G T 17: 70,996,171 N95K probably benign Het
Myo1h A G 5: 114,328,811 probably null Het
Myrf G A 19: 10,219,619 P266S possibly damaging Het
Ncf1 A G 5: 134,222,095 V330A possibly damaging Het
Nfasc T C 1: 132,605,549 D638G probably damaging Het
Nkapl T C 13: 21,467,267 K392R possibly damaging Het
Olfr131 A G 17: 38,082,402 V192A probably benign Het
Olfr2 A T 7: 107,001,307 C184* probably null Het
Pelo T A 13: 115,089,648 N91I probably damaging Het
Ptk2b T C 14: 66,158,401 N836D probably benign Het
Pwp2 A T 10: 78,182,944 probably null Het
Slc44a1 G A 4: 53,517,657 V127I probably benign Het
Snx13 A G 12: 35,105,175 T413A probably benign Het
Spaca7 C T 8: 12,585,696 P71S probably damaging Het
Spef2 A T 15: 9,609,551 M1296K possibly damaging Het
Suco G A 1: 161,829,321 A978V probably benign Het
Tcerg1 A G 18: 42,536,937 E494G probably benign Het
Tenm2 A G 11: 36,106,799 V821A probably benign Het
Tg T A 15: 66,693,263 D1151E probably benign Het
Trp53bp2 A G 1: 182,455,819 E1040G probably damaging Het
Ubap2 A T 4: 41,233,655 N79K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Yars2 T G 16: 16,304,521 probably null Het
Ylpm1 A G 12: 85,048,866 I1847V possibly damaging Het
Other mutations in Olfr914
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr914 APN 9 38606554 missense probably null 0.00
IGL01758:Olfr914 APN 9 38607293 missense probably damaging 0.99
IGL02003:Olfr914 APN 9 38606840 missense probably damaging 1.00
IGL02203:Olfr914 APN 9 38607423 utr 3 prime probably benign
IGL02233:Olfr914 APN 9 38607242 missense probably damaging 1.00
IGL02408:Olfr914 APN 9 38607121 missense possibly damaging 0.62
IGL02882:Olfr914 APN 9 38606938 missense probably benign 0.04
IGL03081:Olfr914 APN 9 38606870 missense probably benign 0.01
IGL03088:Olfr914 APN 9 38607301 missense probably damaging 0.99
IGL03177:Olfr914 APN 9 38606571 nonsense probably null
IGL03219:Olfr914 APN 9 38606951 missense probably benign 0.28
P0023:Olfr914 UTSW 9 38606645 missense probably damaging 1.00
R0630:Olfr914 UTSW 9 38606896 missense probably benign 0.01
R0948:Olfr914 UTSW 9 38606491 missense possibly damaging 0.65
R1451:Olfr914 UTSW 9 38606938 missense probably benign 0.04
R1681:Olfr914 UTSW 9 38606948 missense probably damaging 0.99
R2402:Olfr914 UTSW 9 38607101 missense probably benign 0.02
R5854:Olfr914 UTSW 9 38606663 missense probably damaging 1.00
R6857:Olfr914 UTSW 9 38607011 missense probably benign 0.07
R7452:Olfr914 UTSW 9 38607088 missense probably benign 0.34
R7921:Olfr914 UTSW 9 38606412 start gained probably benign
R8039:Olfr914 UTSW 9 38607389 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTCAGTCTCAGCAAGGTG -3'
(R):5'- TGTGTGAAGGTGAGAATTCAACAC -3'

Sequencing Primer
(F):5'- GTCTCAGCAAGGTGGACCATTATC -3'
(R):5'- AAGTCAAATTTCCAAATGCTGTTATC -3'
Posted On2019-12-20