Incidental Mutation 'R7839:Rabl6'
ID606145
Institutional Source Beutler Lab
Gene Symbol Rabl6
Ensembl Gene ENSMUSG00000015087
Gene NameRAB, member RAS oncogene family-like 6
SynonymsRbel1, Rbel1a, B230208H17Rik, Rbel1b
Accession Numbers

Genbank: NM_001024616; MGI: 2442633

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7839 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25583018-25608521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25592817 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 183 (H183Q)
Ref Sequence ENSEMBL: ENSMUSP00000058746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058137]
Predicted Effect probably damaging
Transcript: ENSMUST00000058137
AA Change: H183Q

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087
AA Change: H183Q

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small GTPases. The encoded protein binds to both GTP and GDP and may play a role in cell growth and survival. Overexpression of this gene may play a role in breast cancer tumorigenesis, and pseudogenes of this gene are located on the long arm of chromosome 2 and the short arm of chromosome 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr287 T C 15: 98,208,145 I80V probably damaging Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r34 T A 7: 7,684,174 I175F possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Rabl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Rabl6 APN 2 25584120 unclassified probably benign
IGL00742:Rabl6 APN 2 25588687 missense probably damaging 0.96
IGL02231:Rabl6 APN 2 25598184 missense probably benign 0.41
IGL02424:Rabl6 APN 2 25587457 missense probably benign
IGL02514:Rabl6 APN 2 25608176 missense probably damaging 0.96
IGL03036:Rabl6 APN 2 25584856 missense probably benign 0.00
IGL03278:Rabl6 APN 2 25583822 unclassified probably benign
R0017:Rabl6 UTSW 2 25602567 splice site probably benign
R0269:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0442:Rabl6 UTSW 2 25587522 missense probably damaging 0.98
R0617:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0626:Rabl6 UTSW 2 25592766 critical splice donor site probably null
R1109:Rabl6 UTSW 2 25587526 missense probably damaging 1.00
R2034:Rabl6 UTSW 2 25585432 missense possibly damaging 0.59
R3914:Rabl6 UTSW 2 25588706 missense possibly damaging 0.91
R4255:Rabl6 UTSW 2 25584779 missense possibly damaging 0.91
R5177:Rabl6 UTSW 2 25585373 missense probably benign 0.18
R5389:Rabl6 UTSW 2 25588654 missense probably damaging 0.96
R6082:Rabl6 UTSW 2 25583825 unclassified probably benign
R6243:Rabl6 UTSW 2 25585403 missense probably damaging 0.98
R6430:Rabl6 UTSW 2 25584837 missense probably damaging 0.96
R6501:Rabl6 UTSW 2 25602447 missense possibly damaging 0.92
R7485:Rabl6 UTSW 2 25584141 missense unknown
R7889:Rabl6 UTSW 2 25584774 critical splice donor site probably null
R7922:Rabl6 UTSW 2 25592817 missense probably damaging 0.97
R7972:Rabl6 UTSW 2 25584774 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGGCATATGGTCTTCACATC -3'
(R):5'- CAAGTGCTCTGGGGAGTTAG -3'

Sequencing Primer
(F):5'- TCGTGGAAACCTGGAATTCC -3'
(R):5'- TGCTCTGGGGAGTTAGACCAAAAAG -3'
Posted On2019-12-20