Incidental Mutation 'R7839:Bfsp1'
ID606149
Institutional Source Beutler Lab
Gene Symbol Bfsp1
Ensembl Gene ENSMUSG00000027420
Gene Namebeaded filament structural protein 1, in lens-CP94
Synonymsfilensin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7839 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location143826528-143863173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143831850 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 313 (I313F)
Ref Sequence ENSEMBL: ENSMUSP00000096899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028907
AA Change: I307F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420
AA Change: I307F

DomainStartEndE-ValueType
Pfam:Filament 34 205 2.5e-13 PFAM
low complexity region 400 411 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099296
AA Change: I313F

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420
AA Change: I313F

DomainStartEndE-ValueType
Filament 32 317 1.05e-6 SMART
low complexity region 406 417 N/A INTRINSIC
low complexity region 550 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr287 T C 15: 98,208,145 I80V probably damaging Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r34 T A 7: 7,684,174 I175F possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Bfsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Bfsp1 APN 2 143831892 missense probably damaging 1.00
IGL01457:Bfsp1 APN 2 143827644 splice site probably benign
IGL02329:Bfsp1 APN 2 143862646 missense probably benign
IGL02354:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02361:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02365:Bfsp1 APN 2 143826736 missense probably damaging 1.00
IGL02407:Bfsp1 APN 2 143826933 missense probably benign 0.00
IGL03118:Bfsp1 APN 2 143827333 missense possibly damaging 0.94
I0000:Bfsp1 UTSW 2 143845968 missense probably damaging 1.00
R0112:Bfsp1 UTSW 2 143827643 splice site probably null
R0657:Bfsp1 UTSW 2 143827650 splice site probably benign
R1642:Bfsp1 UTSW 2 143841763 missense probably damaging 1.00
R1816:Bfsp1 UTSW 2 143841679 missense probably benign 0.23
R2061:Bfsp1 UTSW 2 143862678 missense probably benign 0.08
R2248:Bfsp1 UTSW 2 143827652 splice site probably null
R3024:Bfsp1 UTSW 2 143845959 missense probably benign 0.19
R4029:Bfsp1 UTSW 2 143831829 splice site probably benign
R4914:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4915:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4917:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4918:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R5018:Bfsp1 UTSW 2 143862882 missense possibly damaging 0.81
R5202:Bfsp1 UTSW 2 143826971 missense probably benign
R5267:Bfsp1 UTSW 2 143827051 missense probably benign 0.03
R5304:Bfsp1 UTSW 2 143827291 missense probably benign 0.34
R5825:Bfsp1 UTSW 2 143827459 missense probably benign 0.01
R6465:Bfsp1 UTSW 2 143858055 critical splice donor site probably null
R6888:Bfsp1 UTSW 2 143826719 missense probably benign 0.31
R7036:Bfsp1 UTSW 2 143826923 missense possibly damaging 0.65
R7075:Bfsp1 UTSW 2 143848965 missense probably damaging 1.00
R7362:Bfsp1 UTSW 2 143826875 missense probably benign 0.19
R7538:Bfsp1 UTSW 2 143831835 critical splice donor site probably null
R7922:Bfsp1 UTSW 2 143831850 missense possibly damaging 0.79
X0022:Bfsp1 UTSW 2 143858117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCCAAATCTCCAGTG -3'
(R):5'- GCATGCTCATGAGTGTTACG -3'

Sequencing Primer
(F):5'- TGCTACACCTTCAAGTCAGGG -3'
(R):5'- TCATGAGTGTTACGATGAGGAGCTAC -3'
Posted On2019-12-20