Incidental Mutation 'R7839:Ppa2'
ID606152
Institutional Source Beutler Lab
Gene Symbol Ppa2
Ensembl Gene ENSMUSG00000028013
Gene Namepyrophosphatase (inorganic) 2
Synonyms1110013G13Rik, Sid6306
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7839 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location133310110-133378235 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 133376590 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029644] [ENSMUST00000106315] [ENSMUST00000122334]
Predicted Effect probably null
Transcript: ENSMUST00000029644
SMART Domains Protein: ENSMUSP00000029644
Gene: ENSMUSG00000028013

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Pyrophosphatase 89 271 8.4e-59 PFAM
Predicted Effect silent
Transcript: ENSMUST00000106315
SMART Domains Protein: ENSMUSP00000101922
Gene: ENSMUSG00000028013

DomainStartEndE-ValueType
Pfam:Pyrophosphatase 1 97 7.6e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122334
SMART Domains Protein: ENSMUSP00000113369
Gene: ENSMUSG00000028013

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Pyrophosphatase 88 272 1.5e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized to the mitochondrion, is highly similar to members of the inorganic pyrophosphatase (PPase) family, and contains the signature sequence essential for the catalytic activity of PPase. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr287 T C 15: 98,208,145 I80V probably damaging Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r34 T A 7: 7,684,174 I175F possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Ppa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Ppa2 APN 3 133377862 missense probably damaging 1.00
IGL02662:Ppa2 APN 3 133367883 missense probably damaging 0.99
IGL02726:Ppa2 APN 3 133370461 missense possibly damaging 0.46
R0098:Ppa2 UTSW 3 133370473 splice site probably benign
R0098:Ppa2 UTSW 3 133370473 splice site probably benign
R1868:Ppa2 UTSW 3 133348097 missense probably damaging 1.00
R2082:Ppa2 UTSW 3 133370417 missense probably benign 0.00
R2096:Ppa2 UTSW 3 133326684 missense probably damaging 1.00
R2851:Ppa2 UTSW 3 133321003 splice site probably null
R3611:Ppa2 UTSW 3 133348106 missense probably benign 0.07
R4299:Ppa2 UTSW 3 133367842 missense probably damaging 1.00
R4660:Ppa2 UTSW 3 133326684 missense probably damaging 1.00
R4735:Ppa2 UTSW 3 133370425 missense probably benign 0.29
R5023:Ppa2 UTSW 3 133370434 missense probably benign 0.08
R5881:Ppa2 UTSW 3 133330439 missense probably damaging 0.96
R6284:Ppa2 UTSW 3 133370417 missense probably benign 0.00
R7194:Ppa2 UTSW 3 133348192 critical splice donor site probably null
R7203:Ppa2 UTSW 3 133330438 missense possibly damaging 0.93
R7787:Ppa2 UTSW 3 133330498 missense probably damaging 1.00
R7922:Ppa2 UTSW 3 133376590 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTATTTCTGAGCATGCGTTC -3'
(R):5'- GTAGCAAGACTACTGAGATGGTTC -3'

Sequencing Primer
(F):5'- GGGGGCTCATTTCTTAGAAAGAATC -3'
(R):5'- TGGTTCAGGGTGAGGGAAC -3'
Posted On2019-12-20