Incidental Mutation 'R7839:Cyp2j12'
ID606153
Institutional Source Beutler Lab
Gene Symbol Cyp2j12
Ensembl Gene ENSMUSG00000081225
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 12
SynonymsOTTMUSG00000007939, Cyp2j12-ps
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7839 (G1)
Quality Score171.009
Status Validated
Chromosome4
Chromosomal Location96099318-96141152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96099656 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 499 (V499A)
Ref Sequence ENSEMBL: ENSMUSP00000133811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097972] [ENSMUST00000121694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097972
AA Change: V499A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133811
Gene: ENSMUSG00000081225
AA Change: V499A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 498 8.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121694
SMART Domains Protein: ENSMUSP00000134394
Gene: ENSMUSG00000081225

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
SCOP:d1cpt__ 39 70 2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr287 T C 15: 98,208,145 I80V probably damaging Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r34 T A 7: 7,684,174 I175F possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Cyp2j12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Cyp2j12 APN 4 96106589 splice site probably benign
IGL01655:Cyp2j12 APN 4 96115577 missense possibly damaging 0.79
IGL01723:Cyp2j12 APN 4 96102126 missense possibly damaging 0.56
IGL01737:Cyp2j12 APN 4 96122658 makesense probably null
IGL01936:Cyp2j12 APN 4 96133069 missense probably benign 0.01
IGL01962:Cyp2j12 APN 4 96099762 missense probably benign 0.10
IGL02691:Cyp2j12 APN 4 96132994 critical splice donor site probably null
R0255:Cyp2j12 UTSW 4 96141025 missense probably benign 0.38
R0613:Cyp2j12 UTSW 4 96102079 missense probably damaging 1.00
R0827:Cyp2j12 UTSW 4 96112862 splice site probably benign
R1016:Cyp2j12 UTSW 4 96112865 critical splice donor site probably null
R1251:Cyp2j12 UTSW 4 96115666 nonsense probably null
R1753:Cyp2j12 UTSW 4 96121432 splice site probably null
R2258:Cyp2j12 UTSW 4 96133078 missense probably damaging 1.00
R4471:Cyp2j12 UTSW 4 96133069 missense probably benign 0.01
R4559:Cyp2j12 UTSW 4 96112957 missense probably damaging 0.99
R4702:Cyp2j12 UTSW 4 96132993 critical splice donor site probably null
R4923:Cyp2j12 UTSW 4 96102109 missense possibly damaging 0.91
R4928:Cyp2j12 UTSW 4 96102151 splice site probably null
R5591:Cyp2j12 UTSW 4 96141122 start gained probably benign
R5897:Cyp2j12 UTSW 4 96102042 missense probably damaging 1.00
R6176:Cyp2j12 UTSW 4 96140837 missense probably damaging 0.99
R6942:Cyp2j12 UTSW 4 96112864 critical splice donor site probably null
R7422:Cyp2j12 UTSW 4 96140985 missense probably benign 0.05
R7453:Cyp2j12 UTSW 4 96102126 missense possibly damaging 0.95
R7922:Cyp2j12 UTSW 4 96099656 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGTCAGTCCAGGAATTTGATTC -3'
(R):5'- AGGAAGTTGGGGACTCCATC -3'

Sequencing Primer
(F):5'- CAGTCCAGGAATTTGATTCAACTTCC -3'
(R):5'- GCTGAGAAAGTAACTCATCTTCTGG -3'
Posted On2019-12-20