Incidental Mutation 'R7839:Nlrp9b'
ID606162
Institutional Source Beutler Lab
Gene Symbol Nlrp9b
Ensembl Gene ENSMUSG00000060508
Gene NameNLR family, pyrin domain containing 9B
SynonymsNalp-delta, Nalp9b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7839 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19991465-20073306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20024473 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 545 (R545H)
Ref Sequence ENSEMBL: ENSMUSP00000072895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073151] [ENSMUST00000117909] [ENSMUST00000137183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073151
AA Change: R545H

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072895
Gene: ENSMUSG00000060508
AA Change: R545H

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 311 4.3e-34 PFAM
low complexity region 580 595 N/A INTRINSIC
LRR 630 657 2.16e2 SMART
LRR 691 718 2.23e2 SMART
LRR 747 774 6.67e-2 SMART
LRR 776 803 3.65e0 SMART
LRR 804 831 5.59e-4 SMART
LRR 833 860 2.81e0 SMART
LRR 861 888 8.87e-7 SMART
LRR 890 917 9.24e1 SMART
Blast:LRR 918 945 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117909
SMART Domains Protein: ENSMUSP00000113762
Gene: ENSMUSG00000060508

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 179 2.8e-6 PFAM
LRR 190 217 2.16e2 SMART
LRR 251 278 2.23e2 SMART
LRR 307 334 6.67e-2 SMART
LRR 336 363 3.65e0 SMART
LRR 364 391 5.59e-4 SMART
LRR 393 420 2.81e0 SMART
Pfam:Chromo_shadow 450 501 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137183
SMART Domains Protein: ENSMUSP00000115158
Gene: ENSMUSG00000060508

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 240 1.7e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
PHENOTYPE: The protein protects against rotavirus infection. Homozygous KO leads to increased susceptibility to infection and greater severity of pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr287 T C 15: 98,208,145 I80V probably damaging Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r34 T A 7: 7,684,174 I175F possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Nlrp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Nlrp9b APN 7 20023278 missense probably benign 0.43
IGL00675:Nlrp9b APN 7 20023186 missense possibly damaging 0.63
IGL00755:Nlrp9b APN 7 20023522 missense probably damaging 1.00
IGL01131:Nlrp9b APN 7 20023537 missense probably damaging 1.00
IGL01134:Nlrp9b APN 7 20023187 missense probably benign 0.06
IGL01464:Nlrp9b APN 7 20062655 missense probably benign 0.00
IGL01514:Nlrp9b APN 7 20045934 critical splice donor site probably null
IGL01731:Nlrp9b APN 7 20023417 nonsense probably null
IGL02427:Nlrp9b APN 7 20042501 missense probably damaging 1.00
IGL03013:Nlrp9b APN 7 20048825 missense probably damaging 1.00
R0037:Nlrp9b UTSW 7 20023722 missense probably damaging 0.99
R0114:Nlrp9b UTSW 7 20024056 missense probably benign 0.00
R0276:Nlrp9b UTSW 7 20028498 missense probably benign 0.21
R0346:Nlrp9b UTSW 7 20024515 missense probably damaging 0.99
R0736:Nlrp9b UTSW 7 20049450 missense probably damaging 1.00
R1449:Nlrp9b UTSW 7 20023164 missense possibly damaging 0.91
R1540:Nlrp9b UTSW 7 20048847 nonsense probably null
R1648:Nlrp9b UTSW 7 20026544 missense possibly damaging 0.89
R1878:Nlrp9b UTSW 7 20028564 missense probably benign 0.01
R1903:Nlrp9b UTSW 7 20023257 missense probably benign 0.44
R2191:Nlrp9b UTSW 7 20023662 missense probably benign
R4572:Nlrp9b UTSW 7 20026681 critical splice donor site probably null
R4863:Nlrp9b UTSW 7 20049596 critical splice donor site probably null
R4939:Nlrp9b UTSW 7 20024496 missense probably damaging 0.99
R5211:Nlrp9b UTSW 7 20049456 missense probably damaging 1.00
R5329:Nlrp9b UTSW 7 20023991 missense probably damaging 1.00
R5580:Nlrp9b UTSW 7 20023164 missense probably damaging 0.98
R5696:Nlrp9b UTSW 7 20024492 missense probably benign 0.02
R6265:Nlrp9b UTSW 7 20062683 missense probably benign
R6456:Nlrp9b UTSW 7 20048778 missense probably damaging 1.00
R6672:Nlrp9b UTSW 7 20019338 missense probably damaging 1.00
R6750:Nlrp9b UTSW 7 20023234 nonsense probably null
R6896:Nlrp9b UTSW 7 20023245 missense probably damaging 0.96
R6968:Nlrp9b UTSW 7 20049508 missense probably damaging 1.00
R7108:Nlrp9b UTSW 7 20045930 missense probably damaging 1.00
R7287:Nlrp9b UTSW 7 20028456 missense probably damaging 0.97
R7297:Nlrp9b UTSW 7 20049513 missense possibly damaging 0.81
R7485:Nlrp9b UTSW 7 20023950 missense probably damaging 1.00
R7552:Nlrp9b UTSW 7 20045766 missense probably benign 0.04
R7573:Nlrp9b UTSW 7 20019200 missense probably damaging 1.00
R7690:Nlrp9b UTSW 7 20024370 missense probably benign 0.00
R7913:Nlrp9b UTSW 7 20045800 missense probably benign 0.07
R7922:Nlrp9b UTSW 7 20024473 missense possibly damaging 0.49
R7994:Nlrp9b UTSW 7 20045800 missense probably benign 0.07
R8113:Nlrp9b UTSW 7 20019335 missense probably benign 0.02
X0064:Nlrp9b UTSW 7 20048758 missense probably damaging 1.00
Z1088:Nlrp9b UTSW 7 20023743 missense probably benign 0.01
Z1177:Nlrp9b UTSW 7 20026646 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAACATGTATGCTCGTGGCC -3'
(R):5'- AATGGTCTGGGCAGTAGATTTC -3'

Sequencing Primer
(F):5'- AGACCCAGTGGCTCCAGTTAG -3'
(R):5'- GCAGAGCATATGCAGTCA -3'
Posted On2019-12-20