Incidental Mutation 'R7839:Zfp383'
ID606164
Institutional Source Beutler Lab
Gene Symbol Zfp383
Ensembl Gene ENSMUSG00000099689
Gene Namezinc finger protein 383
Synonyms1110003H10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R7839 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29908223-29916813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29915058 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 246 (C246Y)
Ref Sequence ENSEMBL: ENSMUSP00000140742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186475] [ENSMUST00000187028]
Predicted Effect probably damaging
Transcript: ENSMUST00000186475
AA Change: C246Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140742
Gene: ENSMUSG00000099689
AA Change: C246Y

DomainStartEndE-ValueType
KRAB 27 87 4.95e-37 SMART
low complexity region 165 173 N/A INTRINSIC
ZnF_C2H2 185 207 1.47e-3 SMART
ZnF_C2H2 213 235 7.15e-2 SMART
ZnF_C2H2 241 263 1.79e-2 SMART
ZnF_C2H2 269 291 4.17e-3 SMART
ZnF_C2H2 297 319 3.69e-4 SMART
ZnF_C2H2 325 347 2.27e-4 SMART
ZnF_C2H2 353 375 1.84e-4 SMART
ZnF_C2H2 381 403 6.52e-5 SMART
ZnF_C2H2 409 431 1.58e-3 SMART
ZnF_C2H2 437 459 1.69e-3 SMART
ZnF_C2H2 465 487 1.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187028
SMART Domains Protein: ENSMUSP00000141019
Gene: ENSMUSG00000099689

DomainStartEndE-ValueType
KRAB 27 87 5.6e-22 SMART
low complexity region 124 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a KRAB-related zinc finger protein that inhibits the transcription of some MAPK signaling pathway genes. The repressor activity resides in the KRAB domain of the encoded protein. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr287 T C 15: 98,208,145 I80V probably damaging Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r34 T A 7: 7,684,174 I175F possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Zfp383
AlleleSourceChrCoordTypePredicted EffectPPH Score
flyer UTSW 7 29914727 missense probably benign
R4796:Zfp383 UTSW 7 29914838 missense possibly damaging 0.72
R5114:Zfp383 UTSW 7 29914741 missense probably damaging 1.00
R5372:Zfp383 UTSW 7 29915270 nonsense probably null
R5622:Zfp383 UTSW 7 29912190 missense probably damaging 1.00
R5963:Zfp383 UTSW 7 29915678 missense possibly damaging 0.84
R6639:Zfp383 UTSW 7 29914727 missense probably benign
R6952:Zfp383 UTSW 7 29914955 missense probably benign 0.00
R7067:Zfp383 UTSW 7 29908646 start codon destroyed probably null 0.01
R7635:Zfp383 UTSW 7 29915271 missense probably damaging 1.00
R7809:Zfp383 UTSW 7 29910236 missense possibly damaging 0.86
R7896:Zfp383 UTSW 7 29912201 missense probably damaging 0.99
R7922:Zfp383 UTSW 7 29915058 missense probably damaging 1.00
R7979:Zfp383 UTSW 7 29912201 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCACATTCTTTCAGCAGACCT -3'
(R):5'- GCTATGGGGCTTGTCATCGC -3'

Sequencing Primer
(F):5'- TGATGAGAAACCCTACGAATGTAAG -3'
(R):5'- AAAGGTTTCTCGCCAGCATG -3'
Posted On2019-12-20