Mutagenetix > Incidental Mutation

Incidental Mutation 'R7839:Slc6a15'

606173

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7839 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103404799 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 428 (I428V)

Ref Sequence

ENSEMBL: ENSMUSP00000073829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]

AlphaFold

Q8BG16

Predicted Effect

probably benign
Transcript: ENSMUST00000074204
AA Change: I428V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: I428V

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179636
AA Change: I428V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: I428V

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Meta Mutation Damage Score

0.0670

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	T	11: 110,134,259	M986K	probably benign	Het
Adcyap1	A	G	17: 93,203,985	K129R	probably benign	Het
Anapc1	T	C	2: 128,684,608	D90G	probably damaging	Het
Ankrd17	G	A	5: 90,263,354	H1361Y	probably damaging	Het
Aqp4	T	A	18: 15,399,680	I119F	possibly damaging	Het
Bfsp1	T	A	2: 143,831,850	I313F	possibly damaging	Het
C130026I21Rik	C	T	1: 85,247,015	M266I	probably benign	Het
Cxcl9	A	G	5: 92,328,010	V5A	probably benign	Het
Cyfip1	G	A	7: 55,886,735	V304M	probably damaging	Het
Cyp2d22	A	G	15: 82,372,571	V334A	probably damaging	Het
Cyp2j12	A	G	4: 96,099,656	V499A	possibly damaging	Het
Cyth3	A	G	5: 143,697,754	E136G	probably benign	Het
Degs2	CTTAGTGAAT	CT	12: 108,692,201		probably null	Het
Dnah7a	A	G	1: 53,567,175	S1229P	probably benign	Het
Dopey1	T	A	9: 86,542,765	C2087*	probably null	Het
Dopey2	A	T	16: 93,763,941	H889L	probably damaging	Het
Elf1	A	G	14: 79,536,415	E22G	probably benign	Het
Gbgt1	T	C	2: 28,503,170	V90A	probably damaging	Het
Glis3	T	C	19: 28,317,373	D675G	possibly damaging	Het
Glt8d1	G	T	14: 31,001,831		probably benign	Het
Gm12166	T	C	11: 46,052,060	T79A	possibly damaging	Het
Gzf1	T	A	2: 148,683,895	Y95*	probably null	Het
Insig2	T	C	1: 121,312,320	I84V	probably benign	Het
Mapkapk2	A	G	1: 131,097,519	S3P	unknown	Het
Mettl7a1	T	C	15: 100,305,076	V77A	possibly damaging	Het
Nell2	T	C	15: 95,298,938	N499S	probably benign	Het
Nlrp9b	G	A	7: 20,024,473	R545H	possibly damaging	Het
Obox7	T	A	7: 14,665,425	I192N	probably benign	Het
Olfr287	T	C	15: 98,208,145	I80V	probably damaging	Het
Olfr813	A	T	10: 129,857,030	I171F	possibly damaging	Het
Plec	A	T	15: 76,176,383	V3118E	probably damaging	Het
Plk3	T	C	4: 117,129,330	T571A	probably damaging	Het
Ppa2	T	C	3: 133,376,590		probably null	Het
Rabl6	A	T	2: 25,592,817	H183Q	probably damaging	Het
Rad51ap2	T	A	12: 11,457,237	S387T	possibly damaging	Het
Rbm33	A	G	5: 28,368,399		probably null	Het
Robo4	T	C	9: 37,410,759	S724P	probably damaging	Het
Rtf2	T	C	2: 172,466,333		probably null	Het
Slc45a2	A	T	15: 11,027,749	Q468L	probably benign	Het
Taar7f	C	A	10: 24,050,069	A187E	possibly damaging	Het
Tob1	T	A	11: 94,213,772	Y45N	probably damaging	Het
Trappc10	A	G	10: 78,188,812	V1161A	possibly damaging	Het
Trbv13-2	T	C	6: 41,121,587	V32A	probably benign	Het
Trpm8	T	A	1: 88,326,454	L133Q	possibly damaging	Het
Ttn	T	C	2: 76,708,168	T34729A	probably benign	Het
Uba6	G	T	5: 86,122,412		probably null	Het
Unc13c	T	C	9: 73,933,314	D85G	possibly damaging	Het
Vmn1r176	T	C	7: 23,834,969	D253G	possibly damaging	Het
Vmn2r34	T	A	7: 7,684,174	I175F	possibly damaging	Het
Vmn2r61	T	A	7: 42,266,608	I215N	probably damaging	Het
Vwa5a	C	A	9: 38,723,503	S202R	probably damaging	Het
Zfp383	G	A	7: 29,915,058	C246Y	probably damaging	Het
Zfp40	T	C	17: 23,176,989	D208G	probably damaging	Het
Zfp992	C	A	4: 146,466,418	L199I	probably benign	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACTAGCATTTCATGGCATAATTC -3'
(R):5'- GTAAACACACTCTATGAGATGCAC -3'

Sequencing Primer
(F):5'- ACTTTTCAGAAACTCCGAGATGATC -3'
(R):5'- CTCTATGAGATGCACAGTTATCGGAG -3'

Posted On

2019-12-20