Incidental Mutation 'R7839:Olfr287'
ID606185
Institutional Source Beutler Lab
Gene Symbol Olfr287
Ensembl Gene ENSMUSG00000090129
Gene Nameolfactory receptor 287
SynonymsMOR286-1, GA_x6K02T2NBG7-5548201-5549154
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7839 (G1)
Quality Score109.008
Status Not validated
Chromosome15
Chromosomal Location98206971-98221056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98208145 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 80 (I80V)
Ref Sequence ENSEMBL: ENSMUSP00000129271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142443] [ENSMUST00000170618]
Predicted Effect probably benign
Transcript: ENSMUST00000142443
SMART Domains Protein: ENSMUSP00000119026
Gene: ENSMUSG00000075427

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
Pfam:7tm_1 38 287 1.2e-32 PFAM
Pfam:7tm_4 136 280 3.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142443
Predicted Effect probably damaging
Transcript: ENSMUST00000170618
AA Change: I80V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129271
Gene: ENSMUSG00000090129
AA Change: I80V

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 1e-50 PFAM
Pfam:7tm_1 47 296 6e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,134,259 M986K probably benign Het
Adcyap1 A G 17: 93,203,985 K129R probably benign Het
Anapc1 T C 2: 128,684,608 D90G probably damaging Het
Ankrd17 G A 5: 90,263,354 H1361Y probably damaging Het
Aqp4 T A 18: 15,399,680 I119F possibly damaging Het
Bfsp1 T A 2: 143,831,850 I313F possibly damaging Het
C130026I21Rik C T 1: 85,247,015 M266I probably benign Het
Cxcl9 A G 5: 92,328,010 V5A probably benign Het
Cyfip1 G A 7: 55,886,735 V304M probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp2j12 A G 4: 96,099,656 V499A possibly damaging Het
Cyth3 A G 5: 143,697,754 E136G probably benign Het
Degs2 CTTAGTGAAT CT 12: 108,692,201 probably null Het
Dnah7a A G 1: 53,567,175 S1229P probably benign Het
Dopey1 T A 9: 86,542,765 C2087* probably null Het
Dopey2 A T 16: 93,763,941 H889L probably damaging Het
Elf1 A G 14: 79,536,415 E22G probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Glis3 T C 19: 28,317,373 D675G possibly damaging Het
Glt8d1 G T 14: 31,001,831 probably benign Het
Gm12166 T C 11: 46,052,060 T79A possibly damaging Het
Gzf1 T A 2: 148,683,895 Y95* probably null Het
Insig2 T C 1: 121,312,320 I84V probably benign Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mettl7a1 T C 15: 100,305,076 V77A possibly damaging Het
Nell2 T C 15: 95,298,938 N499S probably benign Het
Nlrp9b G A 7: 20,024,473 R545H possibly damaging Het
Obox7 T A 7: 14,665,425 I192N probably benign Het
Olfr813 A T 10: 129,857,030 I171F possibly damaging Het
Plec A T 15: 76,176,383 V3118E probably damaging Het
Plk3 T C 4: 117,129,330 T571A probably damaging Het
Ppa2 T C 3: 133,376,590 probably null Het
Rabl6 A T 2: 25,592,817 H183Q probably damaging Het
Rad51ap2 T A 12: 11,457,237 S387T possibly damaging Het
Rbm33 A G 5: 28,368,399 probably null Het
Robo4 T C 9: 37,410,759 S724P probably damaging Het
Rtf2 T C 2: 172,466,333 probably null Het
Slc45a2 A T 15: 11,027,749 Q468L probably benign Het
Slc6a15 A G 10: 103,404,799 I428V probably benign Het
Taar7f C A 10: 24,050,069 A187E possibly damaging Het
Tob1 T A 11: 94,213,772 Y45N probably damaging Het
Trappc10 A G 10: 78,188,812 V1161A possibly damaging Het
Trbv13-2 T C 6: 41,121,587 V32A probably benign Het
Trpm8 T A 1: 88,326,454 L133Q possibly damaging Het
Ttn T C 2: 76,708,168 T34729A probably benign Het
Uba6 G T 5: 86,122,412 probably null Het
Unc13c T C 9: 73,933,314 D85G possibly damaging Het
Vmn1r176 T C 7: 23,834,969 D253G possibly damaging Het
Vmn2r34 T A 7: 7,684,174 I175F possibly damaging Het
Vmn2r61 T A 7: 42,266,608 I215N probably damaging Het
Vwa5a C A 9: 38,723,503 S202R probably damaging Het
Zfp383 G A 7: 29,915,058 C246Y probably damaging Het
Zfp40 T C 17: 23,176,989 D208G probably damaging Het
Zfp992 C A 4: 146,466,418 L199I probably benign Het
Other mutations in Olfr287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Olfr287 APN 15 98207500 missense probably damaging 0.99
IGL02952:Olfr287 APN 15 98207589 missense probably damaging 1.00
PIT4378001:Olfr287 UTSW 15 98207571 missense probably damaging 1.00
R1079:Olfr287 UTSW 15 98208342 missense probably damaging 0.98
R5932:Olfr287 UTSW 15 98207415 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACACCTTCTGGCTCATGATCTG -3'
(R):5'- GTGACTGAGTTCATCCTCGTG -3'

Sequencing Primer
(F):5'- CTCATGATCTGGGCATAGTTCAG -3'
(R):5'- CATCCTCGTGGGCTTTGAGC -3'
Posted On2019-12-20