Incidental Mutation 'R7840:Nup210l'
ID 606201
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission 045894-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R7840 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90030036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 250 (I250L)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: I250L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: I250L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: I250L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: I250L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,074,689 (GRCm39) N577S probably benign Het
Ang4 A G 14: 52,001,529 (GRCm39) S140P probably damaging Het
Ankdd1b T C 13: 96,556,306 (GRCm39) probably null Het
Anln G T 9: 22,274,019 (GRCm39) A606D probably benign Het
Ano5 T G 7: 51,237,480 (GRCm39) V768G possibly damaging Het
Ccdc180 A T 4: 45,900,461 (GRCm39) Y275F possibly damaging Het
Chpf T C 1: 75,453,271 (GRCm39) Y334C probably damaging Het
Chrdl2 T C 7: 99,682,863 (GRCm39) L381S probably damaging Het
Cibar2 T C 8: 120,893,372 (GRCm39) D273G probably benign Het
Cox20 A T 1: 178,150,126 (GRCm39) Y100F probably benign Het
Dbn1 T C 13: 55,623,322 (GRCm39) D433G possibly damaging Het
Dclre1a A T 19: 56,519,684 (GRCm39) I983N probably damaging Het
Dok6 A T 18: 89,578,182 (GRCm39) H78Q probably benign Het
Efcab3 G A 11: 104,624,539 (GRCm39) D878N probably benign Het
Fpr1 A T 17: 18,097,634 (GRCm39) F118L probably benign Het
Fscn3 A G 6: 28,430,175 (GRCm39) Y115C probably damaging Het
Gabra4 A C 5: 71,798,256 (GRCm39) probably null Het
Gm45861 T C 8: 28,072,751 (GRCm39) V1290A unknown Het
Hivep1 T C 13: 42,308,828 (GRCm39) V356A probably benign Het
Ikbip T C 10: 90,937,617 (GRCm39) Y97H possibly damaging Het
Il10 A G 1: 130,947,805 (GRCm39) T53A probably benign Het
Inpp5f T C 7: 128,296,526 (GRCm39) V959A probably benign Het
Insr T C 8: 3,308,415 (GRCm39) E207G probably benign Het
Kndc1 T A 7: 139,503,731 (GRCm39) S1012T probably damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Ksr2 T C 5: 117,693,329 (GRCm39) V259A probably benign Het
Lox A T 18: 52,658,194 (GRCm39) Y326* probably null Het
Lpin2 C A 17: 71,537,269 (GRCm39) T272N probably benign Het
Lrp2 C T 2: 69,295,128 (GRCm39) E3397K probably damaging Het
Megf11 G A 9: 64,602,709 (GRCm39) C850Y possibly damaging Het
Morc1 T C 16: 48,319,147 (GRCm39) F284L probably benign Het
Moxd2 T A 6: 40,862,378 (GRCm39) D147V possibly damaging Het
Mrpl21 T C 19: 3,337,752 (GRCm39) L153P probably damaging Het
Naip2 T C 13: 100,280,917 (GRCm39) T1432A probably benign Het
Naip6 T A 13: 100,451,979 (GRCm39) D211V probably damaging Het
Ncoa5 T C 2: 164,854,816 (GRCm39) H102R possibly damaging Het
Ndel1 A T 11: 68,720,806 (GRCm39) C293* probably null Het
Ninl A T 2: 150,808,016 (GRCm39) M82K probably benign Het
Nrcam G A 12: 44,587,858 (GRCm39) probably null Het
Obscn T C 11: 58,968,776 (GRCm39) E2532G possibly damaging Het
Or1e1 C A 11: 73,244,585 (GRCm39) A2E probably benign Het
Or5v1 G T 17: 37,809,868 (GRCm39) G109C probably damaging Het
Or8j3c A G 2: 86,253,583 (GRCm39) F146L probably benign Het
Osgin1 G A 8: 120,171,773 (GRCm39) S189N possibly damaging Het
Otud7b A G 3: 96,062,690 (GRCm39) E643G probably damaging Het
Phldb2 T A 16: 45,571,727 (GRCm39) T1222S probably damaging Het
Pwp1 C T 10: 85,723,914 (GRCm39) R472W probably damaging Het
Rad21 T C 15: 51,836,538 (GRCm39) Y211C probably damaging Het
Rexo1 A G 10: 80,386,572 (GRCm39) V162A probably benign Het
Rtl1 C T 12: 109,560,589 (GRCm39) V417I probably benign Het
Setbp1 G A 18: 78,826,639 (GRCm39) P1325S probably benign Het
Shld1 A G 2: 132,592,510 (GRCm39) T186A probably damaging Het
Shld2 A G 14: 33,959,523 (GRCm39) Y820H probably damaging Het
Skint7 G T 4: 111,839,423 (GRCm39) C239F probably benign Het
Slc25a1 A G 16: 17,744,138 (GRCm39) L221P probably benign Het
Snrnp70 T A 7: 45,026,214 (GRCm39) D385V unknown Het
Sp7 A C 15: 102,267,533 (GRCm39) V109G probably benign Het
Syne1 A T 10: 5,082,078 (GRCm39) Y849N probably damaging Het
Tas2r108 T C 6: 40,470,790 (GRCm39) F89L possibly damaging Het
Tcf3 C T 10: 80,246,301 (GRCm39) A581T possibly damaging Het
Tcta A G 9: 108,182,986 (GRCm39) L53P probably damaging Het
Traf3ip2 C G 10: 39,502,451 (GRCm39) Q200E probably damaging Het
Trgc1 A T 13: 19,400,691 (GRCm39) Y140F Het
Tyk2 A T 9: 21,036,263 (GRCm39) C75S probably damaging Het
Ugt3a1 G A 15: 9,311,903 (GRCm39) G382R probably damaging Het
Upp2 G T 2: 58,664,127 (GRCm39) probably null Het
Vmn1r212 A T 13: 23,067,323 (GRCm39) F337I unknown Het
Vmn1r58 T C 7: 5,414,242 (GRCm39) probably benign Het
Vps13d A T 4: 144,830,246 (GRCm39) V2856D Het
Wdr37 A C 13: 8,886,911 (GRCm39) L292R probably damaging Het
Yipf3 T C 17: 46,561,790 (GRCm39) I199T probably benign Het
Zdhhc23 A G 16: 43,791,907 (GRCm39) S289P possibly damaging Het
Zfp229 A T 17: 21,965,131 (GRCm39) K454* probably null Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0090:Nup210l UTSW 3 90,119,086 (GRCm39) missense probably benign 0.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1858:Nup210l UTSW 3 90,061,806 (GRCm39) missense probably damaging 0.97
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5004:Nup210l UTSW 3 90,087,472 (GRCm39) nonsense probably null
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7514:Nup210l UTSW 3 90,117,766 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8084:Nup210l UTSW 3 90,043,365 (GRCm39) missense probably benign 0.15
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8770:Nup210l UTSW 3 90,025,850 (GRCm39) missense probably damaging 1.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9381:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9682:Nup210l UTSW 3 90,051,469 (GRCm39) missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTAGCTTTGGCCAGCGTTG -3'
(R):5'- TGGTCGGTGCACAGCCTT -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- GGTGCACAGCCTTCTCTG -3'
Posted On 2019-12-20