Incidental Mutation 'R7840:Nup210l'
ID606201
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Namenucleoporin 210-like
Synonyms4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R7840 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location90104132-90212048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90122729 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 250 (I250L)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: I250L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: I250L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: I250L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: I250L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A G 2: 132,750,590 T186A probably damaging Het
Abca16 A G 7: 120,475,466 N577S probably benign Het
Ang4 A G 14: 51,764,072 S140P probably damaging Het
Ankdd1b T C 13: 96,419,798 probably null Het
Anln G T 9: 22,362,723 A606D probably benign Het
Ano5 T G 7: 51,587,732 V768G possibly damaging Het
Ccdc180 A T 4: 45,900,461 Y275F possibly damaging Het
Chpf T C 1: 75,476,627 Y334C probably damaging Het
Chrdl2 T C 7: 100,033,656 L381S probably damaging Het
Cox20 A T 1: 178,322,561 Y100F probably benign Het
Dbn1 T C 13: 55,475,509 D433G possibly damaging Het
Dclre1a A T 19: 56,531,252 I983N probably damaging Het
Dok6 A T 18: 89,560,058 H78Q probably benign Het
Dusp9 AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG X: 73,640,522 probably benign Het
Fam35a A G 14: 34,237,566 Y820H probably damaging Het
Fam92b T C 8: 120,166,633 D273G probably benign Het
Fpr1 A T 17: 17,877,372 F118L probably benign Het
Fscn3 A G 6: 28,430,176 Y115C probably damaging Het
Gm11639 G A 11: 104,733,713 D878N probably benign Het
Gm45861 T C 8: 27,582,723 V1290A unknown Het
Hivep1 T C 13: 42,155,352 V356A probably benign Het
Ikbip T C 10: 91,101,755 Y97H possibly damaging Het
Il10 A G 1: 131,020,068 T53A probably benign Het
Inpp5f T C 7: 128,694,802 V959A probably benign Het
Insr T C 8: 3,258,415 E207G probably benign Het
Kndc1 T A 7: 139,923,816 S1012T probably damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Ksr2 T C 5: 117,555,264 V259A probably benign Het
Lox A T 18: 52,525,122 Y326* probably null Het
Lpin2 C A 17: 71,230,274 T272N probably benign Het
Lrp2 C T 2: 69,464,784 E3397K probably damaging Het
Megf11 G A 9: 64,695,427 C850Y possibly damaging Het
Morc1 T C 16: 48,498,784 F284L probably benign Het
Moxd2 T A 6: 40,885,444 D147V possibly damaging Het
Mrpl21 T C 19: 3,287,752 L153P probably damaging Het
Naip2 T C 13: 100,144,409 T1432A probably benign Het
Naip6 T A 13: 100,315,471 D211V probably damaging Het
Ncoa5 T C 2: 165,012,896 H102R possibly damaging Het
Ndel1 A T 11: 68,829,980 C293* probably null Het
Ninl A T 2: 150,966,096 M82K probably benign Het
Nrcam G A 12: 44,541,075 probably null Het
Obscn T C 11: 59,077,950 E2532G possibly damaging Het
Olfr1062 A G 2: 86,423,239 F146L probably benign Het
Olfr110 G T 17: 37,498,977 G109C probably damaging Het
Olfr20 C A 11: 73,353,759 A2E probably benign Het
Osgin1 G A 8: 119,445,034 S189N possibly damaging Het
Otud7b A G 3: 96,155,373 E643G probably damaging Het
Phldb2 T A 16: 45,751,364 T1222S probably damaging Het
Pwp1 C T 10: 85,888,050 R472W probably damaging Het
Rad21 T C 15: 51,973,142 Y211C probably damaging Het
Rexo1 A G 10: 80,550,738 V162A probably benign Het
Rtl1 C T 12: 109,594,155 V417I probably benign Het
Setbp1 G A 18: 78,783,424 P1325S probably benign Het
Skint7 G T 4: 111,982,226 C239F probably benign Het
Slc25a1 A G 16: 17,926,274 L221P probably benign Het
Snrnp70 T A 7: 45,376,790 D385V unknown Het
Sp7 A C 15: 102,359,098 V109G probably benign Het
Syne1 A T 10: 5,132,078 Y849N probably damaging Het
Tas2r108 T C 6: 40,493,856 F89L possibly damaging Het
Tcf3 C T 10: 80,410,467 A581T possibly damaging Het
Tcrg-C1 A T 13: 19,216,521 Y140F Het
Tcta A G 9: 108,305,787 L53P probably damaging Het
Traf3ip2 C G 10: 39,626,455 Q200E probably damaging Het
Tyk2 A T 9: 21,124,967 C75S probably damaging Het
Ugt3a1 G A 15: 9,311,817 G382R probably damaging Het
Upp2 G T 2: 58,774,115 probably null Het
Vmn1r212 A T 13: 22,883,153 F337I unknown Het
Vmn1r58 T C 7: 5,411,243 probably benign Het
Vps13d A T 4: 145,103,676 V2856D Het
Wdr37 A C 13: 8,836,875 L292R probably damaging Het
Yipf3 T C 17: 46,250,864 I199T probably benign Het
Zdhhc23 A G 16: 43,971,544 S289P possibly damaging Het
Zfp229 A T 17: 21,746,150 K454* probably null Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 intron probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R7923:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7930:Nup210l UTSW 3 90151123 missense probably benign
R7931:Nup210l UTSW 3 90203905 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTAGCTTTGGCCAGCGTTG -3'
(R):5'- TGGTCGGTGCACAGCCTT -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- GGTGCACAGCCTTCTCTG -3'
Posted On2019-12-20